Incidental Mutation 'R1386:Kif26b'
ID160554
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission 039448-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1386 (G1)
Quality Score124
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178915644 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1102 (S1102P)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably benign
Transcript: ENSMUST00000160789
AA Change: S655P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: S655P

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161017
AA Change: S1102P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: S1102P

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162545
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,244,255 I235V probably benign Het
Acsm4 T C 7: 119,698,578 I146T probably benign Het
Adgrv1 T C 13: 81,528,865 N1949S probably benign Het
Afdn T C 17: 13,846,536 V630A probably damaging Het
Amfr A G 8: 93,985,399 V301A possibly damaging Het
Anapc16 T C 10: 59,996,457 M45V probably benign Het
Ankrd12 T C 17: 65,983,380 E1686G possibly damaging Het
Ap2m1 T G 16: 20,541,229 H193Q probably damaging Het
Aplnr T C 2: 85,137,461 W277R possibly damaging Het
Aspm A G 1: 139,457,623 E335G probably benign Het
Aspm C T 1: 139,478,972 H1866Y possibly damaging Het
Atp8b4 T A 2: 126,378,744 D578V probably benign Het
Ccr1 T A 9: 123,963,962 E177V probably benign Het
Cecr2 A G 6: 120,762,131 E1245G probably damaging Het
Cep162 A T 9: 87,221,202 C638S probably benign Het
Ces1b A T 8: 93,068,077 I298N probably benign Het
Chdh T A 14: 30,031,434 L100Q probably damaging Het
Chrnd T C 1: 87,192,590 I156T probably damaging Het
Clpx G A 9: 65,326,888 R605Q probably null Het
Cnga1 T A 5: 72,612,183 K135* probably null Het
Col6a4 A T 9: 106,062,945 V1262E probably benign Het
Cracr2b T C 7: 141,463,568 L53P probably damaging Het
Crhr1 T C 11: 104,174,394 S372P possibly damaging Het
Cyp11b2 T A 15: 74,851,775 probably null Het
Cyp21a1 T A 17: 34,802,210 D373V probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah1 A T 3: 145,889,211 Y242F probably benign Het
Dlgap3 A G 4: 127,194,926 D105G possibly damaging Het
Dtl A G 1: 191,569,717 V76A probably damaging Het
Dzank1 A G 2: 144,491,831 S361P probably benign Het
Ehd3 T A 17: 73,820,543 I157N probably damaging Het
Elk4 T C 1: 132,017,830 F149L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83a A G 15: 57,986,503 R148G probably damaging Het
Farp2 C A 1: 93,620,151 probably null Het
Fbxw25 T A 9: 109,654,641 I168F possibly damaging Het
Fermt1 T C 2: 132,916,058 D479G probably damaging Het
Fgf17 C A 14: 70,636,770 R193L probably damaging Het
Foxred2 T G 15: 77,948,521 probably null Het
Gad1 T C 2: 70,574,123 V119A possibly damaging Het
Gas2l3 A G 10: 89,414,353 V301A possibly damaging Het
Gimap8 G A 6: 48,656,653 V469I probably benign Het
Gja1 A T 10: 56,387,969 E141D probably benign Het
Glod4 C T 11: 76,222,003 W268* probably null Het
Gm7173 C T X: 79,509,901 V323I possibly damaging Het
Guf1 C T 5: 69,563,162 H309Y probably benign Het
Hax1 A G 3: 89,995,849 V215A probably damaging Het
Heatr9 T C 11: 83,518,825 D107G probably benign Het
Hephl1 T A 9: 15,076,754 Y686F probably benign Het
Hk3 T C 13: 55,007,030 probably null Het
Ikbkb G T 8: 22,665,617 Q620K possibly damaging Het
Il18rap C T 1: 40,531,522 A208V probably benign Het
Kif5b A T 18: 6,226,383 D147E probably damaging Het
Klhl3 T C 13: 58,030,433 T348A probably damaging Het
Krt10 T C 11: 99,385,920 probably benign Het
Lama3 A T 18: 12,477,370 H1124L probably benign Het
Lin7a A T 10: 107,412,122 Q96L unknown Het
Ly6c2 T G 15: 75,110,589 I37L probably benign Het
Mov10l1 A G 15: 89,011,386 Y585C possibly damaging Het
Msr1 G A 8: 39,589,293 Q414* probably null Het
Myh13 T C 11: 67,370,950 C1900R possibly damaging Het
Obscn T A 11: 59,133,853 N454Y probably damaging Het
Olfml2b T G 1: 170,681,162 Y530D probably damaging Het
Olfr1057 A G 2: 86,374,921 F164L probably damaging Het
Olfr1206 T A 2: 88,865,353 F249L probably benign Het
Olfr1377 T C 11: 50,985,367 F222S probably damaging Het
Olfr1449 A T 19: 12,935,139 T134S probably benign Het
Olfr591 T A 7: 103,173,367 H90L probably benign Het
Olfr868 T A 9: 20,101,582 N274K probably benign Het
Pde10a T G 17: 8,953,742 V648G probably damaging Het
Pde7b T A 10: 20,418,801 H258L probably damaging Het
Pik3cb A G 9: 99,064,027 V582A possibly damaging Het
Plxnb1 T C 9: 109,101,023 S316P probably benign Het
Pmpca C T 2: 26,392,518 T246I probably damaging Het
Reep3 A T 10: 67,063,009 V32D possibly damaging Het
Rfx4 A G 10: 84,863,285 M252V probably damaging Het
Rnf168 C A 16: 32,298,963 D447E probably damaging Het
Rnf31 T C 14: 55,596,764 V518A probably damaging Het
Rnpc3 A T 3: 113,613,784 L340* probably null Het
Scn2a A G 2: 65,688,741 E437G probably damaging Het
Scnn1b C A 7: 121,902,488 N175K possibly damaging Het
Slc39a11 T A 11: 113,247,724 I344F probably benign Het
Slc9a2 T A 1: 40,719,018 L239Q probably damaging Het
Smg5 T C 3: 88,355,671 F794L probably damaging Het
Smim13 C T 13: 41,272,692 S68L possibly damaging Het
Sos2 A T 12: 69,614,658 Y680N probably damaging Het
Spag6 T A 2: 18,734,246 M329K possibly damaging Het
Spire2 G A 8: 123,361,366 probably null Het
Tdrd9 T A 12: 112,044,804 V1149D probably benign Het
Tns3 T A 11: 8,518,261 Y321F probably benign Het
Top3b T C 16: 16,880,629 V112A probably benign Het
Trafd1 G A 5: 121,379,652 T26I probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vmn2r78 T C 7: 86,915,407 L20S unknown Het
Vmn2r82 A T 10: 79,378,711 D176V probably damaging Het
Vps13b T C 15: 35,923,312 F3778L probably damaging Het
Vwa3b T C 1: 37,051,881 probably null Het
Vwc2 C T 11: 11,154,262 P265S probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp335 T C 2: 164,898,241 T764A probably benign Het
Zfp366 T A 13: 99,246,555 V742D probably damaging Het
Zfp709 A T 8: 71,890,662 Y645F probably damaging Het
Zmym2 T A 14: 56,913,091 C424S probably damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGTGCTCCTTTAAGCCAAGCAG -3'
(R):5'- TCCTCACCGTCAACTAGAGTTCCG -3'

Sequencing Primer
(F):5'- CACCCTCTGAGTCTGAAAAGG -3'
(R):5'- CGGGAAACCCTTCGCTC -3'
Posted On2014-03-14