Mutagenetix > Incidental Mutation

Incidental Mutation 'R1386:Scn2a'

160560

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

039448-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65688741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 437 (E437G)

Ref Sequence

ENSEMBL: ENSMUSP00000143882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]

AlphaFold

B1AWN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028377
AA Change: E437G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: E437G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100067
AA Change: E437G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: E437G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138368

Predicted Effect

probably damaging
Transcript: ENSMUST00000144254
AA Change: E437G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: E437G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	7.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
low complexity region	484	502	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200829
AA Change: E437G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: E437G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.5%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,244,255	I235V	probably benign	Het
Acsm4	T	C	7: 119,698,578	I146T	probably benign	Het
Adgrv1	T	C	13: 81,528,865	N1949S	probably benign	Het
Afdn	T	C	17: 13,846,536	V630A	probably damaging	Het
Amfr	A	G	8: 93,985,399	V301A	possibly damaging	Het
Anapc16	T	C	10: 59,996,457	M45V	probably benign	Het
Ankrd12	T	C	17: 65,983,380	E1686G	possibly damaging	Het
Ap2m1	T	G	16: 20,541,229	H193Q	probably damaging	Het
Aplnr	T	C	2: 85,137,461	W277R	possibly damaging	Het
Aspm	A	G	1: 139,457,623	E335G	probably benign	Het
Aspm	C	T	1: 139,478,972	H1866Y	possibly damaging	Het
Atp8b4	T	A	2: 126,378,744	D578V	probably benign	Het
Ccr1	T	A	9: 123,963,962	E177V	probably benign	Het
Cecr2	A	G	6: 120,762,131	E1245G	probably damaging	Het
Cep162	A	T	9: 87,221,202	C638S	probably benign	Het
Ces1b	A	T	8: 93,068,077	I298N	probably benign	Het
Chdh	T	A	14: 30,031,434	L100Q	probably damaging	Het
Chrnd	T	C	1: 87,192,590	I156T	probably damaging	Het
Clpx	G	A	9: 65,326,888	R605Q	probably null	Het
Cnga1	T	A	5: 72,612,183	K135*	probably null	Het
Col6a4	A	T	9: 106,062,945	V1262E	probably benign	Het
Cracr2b	T	C	7: 141,463,568	L53P	probably damaging	Het
Crhr1	T	C	11: 104,174,394	S372P	possibly damaging	Het
Cyp11b2	T	A	15: 74,851,775		probably null	Het
Cyp21a1	T	A	17: 34,802,210	D373V	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddah1	A	T	3: 145,889,211	Y242F	probably benign	Het
Dlgap3	A	G	4: 127,194,926	D105G	possibly damaging	Het
Dtl	A	G	1: 191,569,717	V76A	probably damaging	Het
Dzank1	A	G	2: 144,491,831	S361P	probably benign	Het
Ehd3	T	A	17: 73,820,543	I157N	probably damaging	Het
Elk4	T	C	1: 132,017,830	F149L	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam83a	A	G	15: 57,986,503	R148G	probably damaging	Het
Farp2	C	A	1: 93,620,151		probably null	Het
Fbxw25	T	A	9: 109,654,641	I168F	possibly damaging	Het
Fermt1	T	C	2: 132,916,058	D479G	probably damaging	Het
Fgf17	C	A	14: 70,636,770	R193L	probably damaging	Het
Foxred2	T	G	15: 77,948,521		probably null	Het
Gad1	T	C	2: 70,574,123	V119A	possibly damaging	Het
Gas2l3	A	G	10: 89,414,353	V301A	possibly damaging	Het
Gimap8	G	A	6: 48,656,653	V469I	probably benign	Het
Gja1	A	T	10: 56,387,969	E141D	probably benign	Het
Glod4	C	T	11: 76,222,003	W268*	probably null	Het
Gm7173	C	T	X: 79,509,901	V323I	possibly damaging	Het
Guf1	C	T	5: 69,563,162	H309Y	probably benign	Het
Hax1	A	G	3: 89,995,849	V215A	probably damaging	Het
Heatr9	T	C	11: 83,518,825	D107G	probably benign	Het
Hephl1	T	A	9: 15,076,754	Y686F	probably benign	Het
Hk3	T	C	13: 55,007,030		probably null	Het
Ikbkb	G	T	8: 22,665,617	Q620K	possibly damaging	Het
Il18rap	C	T	1: 40,531,522	A208V	probably benign	Het
Kif26b	T	C	1: 178,915,644	S1102P	probably benign	Het
Kif5b	A	T	18: 6,226,383	D147E	probably damaging	Het
Klhl3	T	C	13: 58,030,433	T348A	probably damaging	Het
Krt10	T	C	11: 99,385,920		probably benign	Het
Lama3	A	T	18: 12,477,370	H1124L	probably benign	Het
Lin7a	A	T	10: 107,412,122	Q96L	unknown	Het
Ly6c2	T	G	15: 75,110,589	I37L	probably benign	Het
Mov10l1	A	G	15: 89,011,386	Y585C	possibly damaging	Het
Msr1	G	A	8: 39,589,293	Q414*	probably null	Het
Myh13	T	C	11: 67,370,950	C1900R	possibly damaging	Het
Obscn	T	A	11: 59,133,853	N454Y	probably damaging	Het
Olfml2b	T	G	1: 170,681,162	Y530D	probably damaging	Het
Olfr1057	A	G	2: 86,374,921	F164L	probably damaging	Het
Olfr1206	T	A	2: 88,865,353	F249L	probably benign	Het
Olfr1377	T	C	11: 50,985,367	F222S	probably damaging	Het
Olfr1449	A	T	19: 12,935,139	T134S	probably benign	Het
Olfr591	T	A	7: 103,173,367	H90L	probably benign	Het
Olfr868	T	A	9: 20,101,582	N274K	probably benign	Het
Pde10a	T	G	17: 8,953,742	V648G	probably damaging	Het
Pde7b	T	A	10: 20,418,801	H258L	probably damaging	Het
Pik3cb	A	G	9: 99,064,027	V582A	possibly damaging	Het
Plxnb1	T	C	9: 109,101,023	S316P	probably benign	Het
Pmpca	C	T	2: 26,392,518	T246I	probably damaging	Het
Reep3	A	T	10: 67,063,009	V32D	possibly damaging	Het
Rfx4	A	G	10: 84,863,285	M252V	probably damaging	Het
Rnf168	C	A	16: 32,298,963	D447E	probably damaging	Het
Rnf31	T	C	14: 55,596,764	V518A	probably damaging	Het
Rnpc3	A	T	3: 113,613,784	L340*	probably null	Het
Scnn1b	C	A	7: 121,902,488	N175K	possibly damaging	Het
Slc39a11	T	A	11: 113,247,724	I344F	probably benign	Het
Slc9a2	T	A	1: 40,719,018	L239Q	probably damaging	Het
Smg5	T	C	3: 88,355,671	F794L	probably damaging	Het
Smim13	C	T	13: 41,272,692	S68L	possibly damaging	Het
Sos2	A	T	12: 69,614,658	Y680N	probably damaging	Het
Spag6	T	A	2: 18,734,246	M329K	possibly damaging	Het
Spire2	G	A	8: 123,361,366		probably null	Het
Tdrd9	T	A	12: 112,044,804	V1149D	probably benign	Het
Tns3	T	A	11: 8,518,261	Y321F	probably benign	Het
Top3b	T	C	16: 16,880,629	V112A	probably benign	Het
Trafd1	G	A	5: 121,379,652	T26I	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Vmn2r78	T	C	7: 86,915,407	L20S	unknown	Het
Vmn2r82	A	T	10: 79,378,711	D176V	probably damaging	Het
Vps13b	T	C	15: 35,923,312	F3778L	probably damaging	Het
Vwa3b	T	C	1: 37,051,881		probably null	Het
Vwc2	C	T	11: 11,154,262	P265S	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zfp335	T	C	2: 164,898,241	T764A	probably benign	Het
Zfp366	T	A	13: 99,246,555	V742D	probably damaging	Het
Zfp709	A	T	8: 71,890,662	Y645F	probably damaging	Het
Zmym2	T	A	14: 56,913,091	C424S	probably damaging	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8172:Scn2a	UTSW	2	65690328	missense	probably benign	0.01
R8220:Scn2a	UTSW	2	65690276	missense	probably benign	0.01
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
R8850:Scn2a	UTSW	2	65688386	missense	probably damaging	1.00
R8897:Scn2a	UTSW	2	65715658	critical splice acceptor site	probably null
R8977:Scn2a	UTSW	2	65763670	missense	probably damaging	0.99
R8992:Scn2a	UTSW	2	65763898	missense	probably damaging	1.00
R9190:Scn2a	UTSW	2	65681002	missense	probably benign	0.00
R9206:Scn2a	UTSW	2	65717787	missense	probably damaging	1.00
R9355:Scn2a	UTSW	2	65764089	missense	probably damaging	1.00
R9452:Scn2a	UTSW	2	65764819	missense	probably benign
R9529:Scn2a	UTSW	2	65764588	missense	probably damaging	0.99
R9567:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R9569:Scn2a	UTSW	2	65730278	missense	probably damaging	1.00
R9657:Scn2a	UTSW	2	65735688	missense	probably damaging	1.00
R9715:Scn2a	UTSW	2	65748805	missense	possibly damaging	0.93
R9761:Scn2a	UTSW	2	65735686	missense	probably damaging	1.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GCATGAGACTCTTGACCAAGGGAAC -3'
(R):5'- TCTGTCCAATGTCAACAGCAGCC -3'

Sequencing Primer
(F):5'- TCTTGACCAAGGGAACTGCTG -3'
(R):5'- TGTCAACAGCAGCCTTCAGG -3'

Posted On

2014-03-14