Incidental Mutation 'R1386:Fermt1'
ID160567
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Namefermitin family member 1
SynonymsKindlin-1, 5830467P10Rik
MMRRC Submission 039448-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1386 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132904389-132945906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132916058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 479 (D479G)
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280]
PDB Structure
Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000038280
AA Change: D479G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356
AA Change: D479G

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134937
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,244,255 I235V probably benign Het
Acsm4 T C 7: 119,698,578 I146T probably benign Het
Adgrv1 T C 13: 81,528,865 N1949S probably benign Het
Afdn T C 17: 13,846,536 V630A probably damaging Het
Amfr A G 8: 93,985,399 V301A possibly damaging Het
Anapc16 T C 10: 59,996,457 M45V probably benign Het
Ankrd12 T C 17: 65,983,380 E1686G possibly damaging Het
Ap2m1 T G 16: 20,541,229 H193Q probably damaging Het
Aplnr T C 2: 85,137,461 W277R possibly damaging Het
Aspm A G 1: 139,457,623 E335G probably benign Het
Aspm C T 1: 139,478,972 H1866Y possibly damaging Het
Atp8b4 T A 2: 126,378,744 D578V probably benign Het
Ccr1 T A 9: 123,963,962 E177V probably benign Het
Cecr2 A G 6: 120,762,131 E1245G probably damaging Het
Cep162 A T 9: 87,221,202 C638S probably benign Het
Ces1b A T 8: 93,068,077 I298N probably benign Het
Chdh T A 14: 30,031,434 L100Q probably damaging Het
Chrnd T C 1: 87,192,590 I156T probably damaging Het
Clpx G A 9: 65,326,888 R605Q probably null Het
Cnga1 T A 5: 72,612,183 K135* probably null Het
Col6a4 A T 9: 106,062,945 V1262E probably benign Het
Cracr2b T C 7: 141,463,568 L53P probably damaging Het
Crhr1 T C 11: 104,174,394 S372P possibly damaging Het
Cyp11b2 T A 15: 74,851,775 probably null Het
Cyp21a1 T A 17: 34,802,210 D373V probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah1 A T 3: 145,889,211 Y242F probably benign Het
Dlgap3 A G 4: 127,194,926 D105G possibly damaging Het
Dtl A G 1: 191,569,717 V76A probably damaging Het
Dzank1 A G 2: 144,491,831 S361P probably benign Het
Ehd3 T A 17: 73,820,543 I157N probably damaging Het
Elk4 T C 1: 132,017,830 F149L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83a A G 15: 57,986,503 R148G probably damaging Het
Farp2 C A 1: 93,620,151 probably null Het
Fbxw25 T A 9: 109,654,641 I168F possibly damaging Het
Fgf17 C A 14: 70,636,770 R193L probably damaging Het
Foxred2 T G 15: 77,948,521 probably null Het
Gad1 T C 2: 70,574,123 V119A possibly damaging Het
Gas2l3 A G 10: 89,414,353 V301A possibly damaging Het
Gimap8 G A 6: 48,656,653 V469I probably benign Het
Gja1 A T 10: 56,387,969 E141D probably benign Het
Glod4 C T 11: 76,222,003 W268* probably null Het
Gm7173 C T X: 79,509,901 V323I possibly damaging Het
Guf1 C T 5: 69,563,162 H309Y probably benign Het
Hax1 A G 3: 89,995,849 V215A probably damaging Het
Heatr9 T C 11: 83,518,825 D107G probably benign Het
Hephl1 T A 9: 15,076,754 Y686F probably benign Het
Hk3 T C 13: 55,007,030 probably null Het
Ikbkb G T 8: 22,665,617 Q620K possibly damaging Het
Il18rap C T 1: 40,531,522 A208V probably benign Het
Kif26b T C 1: 178,915,644 S1102P probably benign Het
Kif5b A T 18: 6,226,383 D147E probably damaging Het
Klhl3 T C 13: 58,030,433 T348A probably damaging Het
Krt10 T C 11: 99,385,920 probably benign Het
Lama3 A T 18: 12,477,370 H1124L probably benign Het
Lin7a A T 10: 107,412,122 Q96L unknown Het
Ly6c2 T G 15: 75,110,589 I37L probably benign Het
Mov10l1 A G 15: 89,011,386 Y585C possibly damaging Het
Msr1 G A 8: 39,589,293 Q414* probably null Het
Myh13 T C 11: 67,370,950 C1900R possibly damaging Het
Obscn T A 11: 59,133,853 N454Y probably damaging Het
Olfml2b T G 1: 170,681,162 Y530D probably damaging Het
Olfr1057 A G 2: 86,374,921 F164L probably damaging Het
Olfr1206 T A 2: 88,865,353 F249L probably benign Het
Olfr1377 T C 11: 50,985,367 F222S probably damaging Het
Olfr1449 A T 19: 12,935,139 T134S probably benign Het
Olfr591 T A 7: 103,173,367 H90L probably benign Het
Olfr868 T A 9: 20,101,582 N274K probably benign Het
Pde10a T G 17: 8,953,742 V648G probably damaging Het
Pde7b T A 10: 20,418,801 H258L probably damaging Het
Pik3cb A G 9: 99,064,027 V582A possibly damaging Het
Plxnb1 T C 9: 109,101,023 S316P probably benign Het
Pmpca C T 2: 26,392,518 T246I probably damaging Het
Reep3 A T 10: 67,063,009 V32D possibly damaging Het
Rfx4 A G 10: 84,863,285 M252V probably damaging Het
Rnf168 C A 16: 32,298,963 D447E probably damaging Het
Rnf31 T C 14: 55,596,764 V518A probably damaging Het
Rnpc3 A T 3: 113,613,784 L340* probably null Het
Scn2a A G 2: 65,688,741 E437G probably damaging Het
Scnn1b C A 7: 121,902,488 N175K possibly damaging Het
Slc39a11 T A 11: 113,247,724 I344F probably benign Het
Slc9a2 T A 1: 40,719,018 L239Q probably damaging Het
Smg5 T C 3: 88,355,671 F794L probably damaging Het
Smim13 C T 13: 41,272,692 S68L possibly damaging Het
Sos2 A T 12: 69,614,658 Y680N probably damaging Het
Spag6 T A 2: 18,734,246 M329K possibly damaging Het
Spire2 G A 8: 123,361,366 probably null Het
Tdrd9 T A 12: 112,044,804 V1149D probably benign Het
Tns3 T A 11: 8,518,261 Y321F probably benign Het
Top3b T C 16: 16,880,629 V112A probably benign Het
Trafd1 G A 5: 121,379,652 T26I probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vmn2r78 T C 7: 86,915,407 L20S unknown Het
Vmn2r82 A T 10: 79,378,711 D176V probably damaging Het
Vps13b T C 15: 35,923,312 F3778L probably damaging Het
Vwa3b T C 1: 37,051,881 probably null Het
Vwc2 C T 11: 11,154,262 P265S probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp335 T C 2: 164,898,241 T764A probably benign Het
Zfp366 T A 13: 99,246,555 V742D probably damaging Het
Zfp709 A T 8: 71,890,662 Y645F probably damaging Het
Zmym2 T A 14: 56,913,091 C424S probably damaging Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132941951 missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132933166 splice site probably benign
IGL02591:Fermt1 APN 2 132934866 missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132933139 missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132906733 missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1474:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1510:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1558:Fermt1 UTSW 2 132934819 critical splice donor site probably null
R1625:Fermt1 UTSW 2 132922831 missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132922842 missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132918525 missense probably benign 0.11
R2264:Fermt1 UTSW 2 132915190 critical splice donor site probably null
R2512:Fermt1 UTSW 2 132939518 splice site probably null
R3765:Fermt1 UTSW 2 132906702 missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132906840 missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132941963 missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132906765 missense probably damaging 0.99
R5303:Fermt1 UTSW 2 132911339 intron probably null
R5304:Fermt1 UTSW 2 132942066 missense probably benign 0.00
R5404:Fermt1 UTSW 2 132934869 missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132915203 missense possibly damaging 0.89
R7146:Fermt1 UTSW 2 132934865 missense probably benign 0.02
R7401:Fermt1 UTSW 2 132917559 missense probably benign
R7561:Fermt1 UTSW 2 132916088 missense probably benign 0.02
X0013:Fermt1 UTSW 2 132918586 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCCTTAATTGGATGCAGCCC -3'
(R):5'- GTTCCCTGTGAGGAATGGCTCAAAG -3'

Sequencing Primer
(F):5'- GTATTGTATAAAACAACCAAGCAGGC -3'
(R):5'- GATAGCTCTGTATCATAGCCCAAGG -3'
Posted On2014-03-14