Incidental Mutation 'R1386:Hax1'
ID 160571
Institutional Source Beutler Lab
Gene Symbol Hax1
Ensembl Gene ENSMUSG00000027944
Gene Name HCLS1 associated X-1
Synonyms HAX-1, Hs1bp1, HS1-associated protein X-1, Silg111, mHAX-1s
MMRRC Submission 039448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1386 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89995446-89998780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89995849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000143155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000079724] [ENSMUST00000196843] [ENSMUST00000197432] [ENSMUST00000197725] [ENSMUST00000197767] [ENSMUST00000197786] [ENSMUST00000198322] [ENSMUST00000198782] [ENSMUST00000199050] [ENSMUST00000199740] [ENSMUST00000199163]
AlphaFold O35387
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079724
AA Change: V241A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078661
Gene: ENSMUSG00000027944
AA Change: V241A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197432
AA Change: V27A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143136
Gene: ENSMUSG00000027944
AA Change: V27A

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197481
Predicted Effect possibly damaging
Transcript: ENSMUST00000197725
AA Change: V112A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142741
Gene: ENSMUSG00000027944
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 119 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197767
AA Change: V238A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142445
Gene: ENSMUSG00000027944
AA Change: V238A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197786
AA Change: V157A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142627
Gene: ENSMUSG00000027944
AA Change: V157A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198782
AA Change: V215A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143155
Gene: ENSMUSG00000027944
AA Change: V215A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199014
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199469
Predicted Effect probably benign
Transcript: ENSMUST00000199740
SMART Domains Protein: ENSMUSP00000143557
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
SCOP:d1qbkb_ 4 18 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199163
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletion of this gene fail to survive beyond 14 weeks of age. Apoptosis of neurons in the striatum and cerebellum occurs as does loss of lymphocytes and neutrophiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,244,255 I235V probably benign Het
Acsm4 T C 7: 119,698,578 I146T probably benign Het
Adgrv1 T C 13: 81,528,865 N1949S probably benign Het
Afdn T C 17: 13,846,536 V630A probably damaging Het
Amfr A G 8: 93,985,399 V301A possibly damaging Het
Anapc16 T C 10: 59,996,457 M45V probably benign Het
Ankrd12 T C 17: 65,983,380 E1686G possibly damaging Het
Ap2m1 T G 16: 20,541,229 H193Q probably damaging Het
Aplnr T C 2: 85,137,461 W277R possibly damaging Het
Aspm A G 1: 139,457,623 E335G probably benign Het
Aspm C T 1: 139,478,972 H1866Y possibly damaging Het
Atp8b4 T A 2: 126,378,744 D578V probably benign Het
Ccr1 T A 9: 123,963,962 E177V probably benign Het
Cecr2 A G 6: 120,762,131 E1245G probably damaging Het
Cep162 A T 9: 87,221,202 C638S probably benign Het
Ces1b A T 8: 93,068,077 I298N probably benign Het
Chdh T A 14: 30,031,434 L100Q probably damaging Het
Chrnd T C 1: 87,192,590 I156T probably damaging Het
Clpx G A 9: 65,326,888 R605Q probably null Het
Cnga1 T A 5: 72,612,183 K135* probably null Het
Col6a4 A T 9: 106,062,945 V1262E probably benign Het
Cracr2b T C 7: 141,463,568 L53P probably damaging Het
Crhr1 T C 11: 104,174,394 S372P possibly damaging Het
Cyp11b2 T A 15: 74,851,775 probably null Het
Cyp21a1 T A 17: 34,802,210 D373V probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah1 A T 3: 145,889,211 Y242F probably benign Het
Dlgap3 A G 4: 127,194,926 D105G possibly damaging Het
Dtl A G 1: 191,569,717 V76A probably damaging Het
Dzank1 A G 2: 144,491,831 S361P probably benign Het
Ehd3 T A 17: 73,820,543 I157N probably damaging Het
Elk4 T C 1: 132,017,830 F149L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83a A G 15: 57,986,503 R148G probably damaging Het
Farp2 C A 1: 93,620,151 probably null Het
Fbxw25 T A 9: 109,654,641 I168F possibly damaging Het
Fermt1 T C 2: 132,916,058 D479G probably damaging Het
Fgf17 C A 14: 70,636,770 R193L probably damaging Het
Foxred2 T G 15: 77,948,521 probably null Het
Gad1 T C 2: 70,574,123 V119A possibly damaging Het
Gas2l3 A G 10: 89,414,353 V301A possibly damaging Het
Gimap8 G A 6: 48,656,653 V469I probably benign Het
Gja1 A T 10: 56,387,969 E141D probably benign Het
Glod4 C T 11: 76,222,003 W268* probably null Het
Gm7173 C T X: 79,509,901 V323I possibly damaging Het
Guf1 C T 5: 69,563,162 H309Y probably benign Het
Heatr9 T C 11: 83,518,825 D107G probably benign Het
Hephl1 T A 9: 15,076,754 Y686F probably benign Het
Hk3 T C 13: 55,007,030 probably null Het
Ikbkb G T 8: 22,665,617 Q620K possibly damaging Het
Il18rap C T 1: 40,531,522 A208V probably benign Het
Kif26b T C 1: 178,915,644 S1102P probably benign Het
Kif5b A T 18: 6,226,383 D147E probably damaging Het
Klhl3 T C 13: 58,030,433 T348A probably damaging Het
Krt10 T C 11: 99,385,920 probably benign Het
Lama3 A T 18: 12,477,370 H1124L probably benign Het
Lin7a A T 10: 107,412,122 Q96L unknown Het
Ly6c2 T G 15: 75,110,589 I37L probably benign Het
Mov10l1 A G 15: 89,011,386 Y585C possibly damaging Het
Msr1 G A 8: 39,589,293 Q414* probably null Het
Myh13 T C 11: 67,370,950 C1900R possibly damaging Het
Obscn T A 11: 59,133,853 N454Y probably damaging Het
Olfml2b T G 1: 170,681,162 Y530D probably damaging Het
Olfr1057 A G 2: 86,374,921 F164L probably damaging Het
Olfr1206 T A 2: 88,865,353 F249L probably benign Het
Olfr1377 T C 11: 50,985,367 F222S probably damaging Het
Olfr1449 A T 19: 12,935,139 T134S probably benign Het
Olfr591 T A 7: 103,173,367 H90L probably benign Het
Olfr868 T A 9: 20,101,582 N274K probably benign Het
Pde10a T G 17: 8,953,742 V648G probably damaging Het
Pde7b T A 10: 20,418,801 H258L probably damaging Het
Pik3cb A G 9: 99,064,027 V582A possibly damaging Het
Plxnb1 T C 9: 109,101,023 S316P probably benign Het
Pmpca C T 2: 26,392,518 T246I probably damaging Het
Reep3 A T 10: 67,063,009 V32D possibly damaging Het
Rfx4 A G 10: 84,863,285 M252V probably damaging Het
Rnf168 C A 16: 32,298,963 D447E probably damaging Het
Rnf31 T C 14: 55,596,764 V518A probably damaging Het
Rnpc3 A T 3: 113,613,784 L340* probably null Het
Scn2a A G 2: 65,688,741 E437G probably damaging Het
Scnn1b C A 7: 121,902,488 N175K possibly damaging Het
Slc39a11 T A 11: 113,247,724 I344F probably benign Het
Slc9a2 T A 1: 40,719,018 L239Q probably damaging Het
Smg5 T C 3: 88,355,671 F794L probably damaging Het
Smim13 C T 13: 41,272,692 S68L possibly damaging Het
Sos2 A T 12: 69,614,658 Y680N probably damaging Het
Spag6 T A 2: 18,734,246 M329K possibly damaging Het
Spire2 G A 8: 123,361,366 probably null Het
Tdrd9 T A 12: 112,044,804 V1149D probably benign Het
Tns3 T A 11: 8,518,261 Y321F probably benign Het
Top3b T C 16: 16,880,629 V112A probably benign Het
Trafd1 G A 5: 121,379,652 T26I probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vmn2r78 T C 7: 86,915,407 L20S unknown Het
Vmn2r82 A T 10: 79,378,711 D176V probably damaging Het
Vps13b T C 15: 35,923,312 F3778L probably damaging Het
Vwa3b T C 1: 37,051,881 probably null Het
Vwc2 C T 11: 11,154,262 P265S probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp335 T C 2: 164,898,241 T764A probably benign Het
Zfp366 T A 13: 99,246,555 V742D probably damaging Het
Zfp709 A T 8: 71,890,662 Y645F probably damaging Het
Zmym2 T A 14: 56,913,091 C424S probably damaging Het
Other mutations in Hax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Hax1 APN 3 89997447 missense possibly damaging 0.90
R0848:Hax1 UTSW 3 89995633 missense probably damaging 1.00
R1479:Hax1 UTSW 3 89995857 missense probably damaging 1.00
R4241:Hax1 UTSW 3 89995690 missense probably damaging 0.96
R4604:Hax1 UTSW 3 89997460 missense probably damaging 0.99
R5354:Hax1 UTSW 3 89997955 missense probably damaging 0.98
R5704:Hax1 UTSW 3 89996096 missense probably damaging 1.00
R5866:Hax1 UTSW 3 89995728 unclassified probably benign
R5905:Hax1 UTSW 3 89997940 small insertion probably benign
R5913:Hax1 UTSW 3 89997940 small insertion probably benign
R5914:Hax1 UTSW 3 89997940 small insertion probably benign
R5973:Hax1 UTSW 3 89997940 small insertion probably benign
R5978:Hax1 UTSW 3 89997940 small insertion probably benign
R6026:Hax1 UTSW 3 89997940 small insertion probably benign
R6028:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6054:Hax1 UTSW 3 89997940 small insertion probably benign
R6857:Hax1 UTSW 3 89997452 missense probably damaging 0.99
R7308:Hax1 UTSW 3 89998566 missense possibly damaging 0.81
R8765:Hax1 UTSW 3 89997473 missense probably benign 0.10
R9132:Hax1 UTSW 3 89995820 missense probably damaging 0.96
R9159:Hax1 UTSW 3 89995820 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCTCTGTTTAAGAACGCTATCGGG -3'
(R):5'- CACTAAGCCAGATGGGGTGAGTTG -3'

Sequencing Primer
(F):5'- TCCTAGTAGCAAATCCAGAATGG -3'
(R):5'- TGAGTTGAGAGGAAGAAGTATAATCC -3'
Posted On 2014-03-14