Mutagenetix > Incidental Mutation

Incidental Mutation 'R1386:Cnga1'

160577

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

039448-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R1386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 72612183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 135 (K135*)

Ref Sequence

ENSEMBL: ENSMUSP00000143881 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000169997] [ENSMUST00000201463]

AlphaFold

P29974

Predicted Effect

probably null
Transcript: ENSMUST00000087213
AA Change: K135*

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: K135*

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000126799

Predicted Effect

probably null
Transcript: ENSMUST00000169997
AA Change: K135*

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: K135*

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000201463
AA Change: K135*

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: K135*

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.5%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,244,255	I235V	probably benign	Het
Acsm4	T	C	7: 119,698,578	I146T	probably benign	Het
Adgrv1	T	C	13: 81,528,865	N1949S	probably benign	Het
Afdn	T	C	17: 13,846,536	V630A	probably damaging	Het
Amfr	A	G	8: 93,985,399	V301A	possibly damaging	Het
Anapc16	T	C	10: 59,996,457	M45V	probably benign	Het
Ankrd12	T	C	17: 65,983,380	E1686G	possibly damaging	Het
Ap2m1	T	G	16: 20,541,229	H193Q	probably damaging	Het
Aplnr	T	C	2: 85,137,461	W277R	possibly damaging	Het
Aspm	A	G	1: 139,457,623	E335G	probably benign	Het
Aspm	C	T	1: 139,478,972	H1866Y	possibly damaging	Het
Atp8b4	T	A	2: 126,378,744	D578V	probably benign	Het
Ccr1	T	A	9: 123,963,962	E177V	probably benign	Het
Cecr2	A	G	6: 120,762,131	E1245G	probably damaging	Het
Cep162	A	T	9: 87,221,202	C638S	probably benign	Het
Ces1b	A	T	8: 93,068,077	I298N	probably benign	Het
Chdh	T	A	14: 30,031,434	L100Q	probably damaging	Het
Chrnd	T	C	1: 87,192,590	I156T	probably damaging	Het
Clpx	G	A	9: 65,326,888	R605Q	probably null	Het
Col6a4	A	T	9: 106,062,945	V1262E	probably benign	Het
Cracr2b	T	C	7: 141,463,568	L53P	probably damaging	Het
Crhr1	T	C	11: 104,174,394	S372P	possibly damaging	Het
Cyp11b2	T	A	15: 74,851,775		probably null	Het
Cyp21a1	T	A	17: 34,802,210	D373V	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddah1	A	T	3: 145,889,211	Y242F	probably benign	Het
Dlgap3	A	G	4: 127,194,926	D105G	possibly damaging	Het
Dtl	A	G	1: 191,569,717	V76A	probably damaging	Het
Dzank1	A	G	2: 144,491,831	S361P	probably benign	Het
Ehd3	T	A	17: 73,820,543	I157N	probably damaging	Het
Elk4	T	C	1: 132,017,830	F149L	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam83a	A	G	15: 57,986,503	R148G	probably damaging	Het
Farp2	C	A	1: 93,620,151		probably null	Het
Fbxw25	T	A	9: 109,654,641	I168F	possibly damaging	Het
Fermt1	T	C	2: 132,916,058	D479G	probably damaging	Het
Fgf17	C	A	14: 70,636,770	R193L	probably damaging	Het
Foxred2	T	G	15: 77,948,521		probably null	Het
Gad1	T	C	2: 70,574,123	V119A	possibly damaging	Het
Gas2l3	A	G	10: 89,414,353	V301A	possibly damaging	Het
Gimap8	G	A	6: 48,656,653	V469I	probably benign	Het
Gja1	A	T	10: 56,387,969	E141D	probably benign	Het
Glod4	C	T	11: 76,222,003	W268*	probably null	Het
Gm7173	C	T	X: 79,509,901	V323I	possibly damaging	Het
Guf1	C	T	5: 69,563,162	H309Y	probably benign	Het
Hax1	A	G	3: 89,995,849	V215A	probably damaging	Het
Heatr9	T	C	11: 83,518,825	D107G	probably benign	Het
Hephl1	T	A	9: 15,076,754	Y686F	probably benign	Het
Hk3	T	C	13: 55,007,030		probably null	Het
Ikbkb	G	T	8: 22,665,617	Q620K	possibly damaging	Het
Il18rap	C	T	1: 40,531,522	A208V	probably benign	Het
Kif26b	T	C	1: 178,915,644	S1102P	probably benign	Het
Kif5b	A	T	18: 6,226,383	D147E	probably damaging	Het
Klhl3	T	C	13: 58,030,433	T348A	probably damaging	Het
Krt10	T	C	11: 99,385,920		probably benign	Het
Lama3	A	T	18: 12,477,370	H1124L	probably benign	Het
Lin7a	A	T	10: 107,412,122	Q96L	unknown	Het
Ly6c2	T	G	15: 75,110,589	I37L	probably benign	Het
Mov10l1	A	G	15: 89,011,386	Y585C	possibly damaging	Het
Msr1	G	A	8: 39,589,293	Q414*	probably null	Het
Myh13	T	C	11: 67,370,950	C1900R	possibly damaging	Het
Obscn	T	A	11: 59,133,853	N454Y	probably damaging	Het
Olfml2b	T	G	1: 170,681,162	Y530D	probably damaging	Het
Olfr1057	A	G	2: 86,374,921	F164L	probably damaging	Het
Olfr1206	T	A	2: 88,865,353	F249L	probably benign	Het
Olfr1377	T	C	11: 50,985,367	F222S	probably damaging	Het
Olfr1449	A	T	19: 12,935,139	T134S	probably benign	Het
Olfr591	T	A	7: 103,173,367	H90L	probably benign	Het
Olfr868	T	A	9: 20,101,582	N274K	probably benign	Het
Pde10a	T	G	17: 8,953,742	V648G	probably damaging	Het
Pde7b	T	A	10: 20,418,801	H258L	probably damaging	Het
Pik3cb	A	G	9: 99,064,027	V582A	possibly damaging	Het
Plxnb1	T	C	9: 109,101,023	S316P	probably benign	Het
Pmpca	C	T	2: 26,392,518	T246I	probably damaging	Het
Reep3	A	T	10: 67,063,009	V32D	possibly damaging	Het
Rfx4	A	G	10: 84,863,285	M252V	probably damaging	Het
Rnf168	C	A	16: 32,298,963	D447E	probably damaging	Het
Rnf31	T	C	14: 55,596,764	V518A	probably damaging	Het
Rnpc3	A	T	3: 113,613,784	L340*	probably null	Het
Scn2a	A	G	2: 65,688,741	E437G	probably damaging	Het
Scnn1b	C	A	7: 121,902,488	N175K	possibly damaging	Het
Slc39a11	T	A	11: 113,247,724	I344F	probably benign	Het
Slc9a2	T	A	1: 40,719,018	L239Q	probably damaging	Het
Smg5	T	C	3: 88,355,671	F794L	probably damaging	Het
Smim13	C	T	13: 41,272,692	S68L	possibly damaging	Het
Sos2	A	T	12: 69,614,658	Y680N	probably damaging	Het
Spag6	T	A	2: 18,734,246	M329K	possibly damaging	Het
Spire2	G	A	8: 123,361,366		probably null	Het
Tdrd9	T	A	12: 112,044,804	V1149D	probably benign	Het
Tns3	T	A	11: 8,518,261	Y321F	probably benign	Het
Top3b	T	C	16: 16,880,629	V112A	probably benign	Het
Trafd1	G	A	5: 121,379,652	T26I	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Vmn2r78	T	C	7: 86,915,407	L20S	unknown	Het
Vmn2r82	A	T	10: 79,378,711	D176V	probably damaging	Het
Vps13b	T	C	15: 35,923,312	F3778L	probably damaging	Het
Vwa3b	T	C	1: 37,051,881		probably null	Het
Vwc2	C	T	11: 11,154,262	P265S	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zfp335	T	C	2: 164,898,241	T764A	probably benign	Het
Zfp366	T	A	13: 99,246,555	V742D	probably damaging	Het
Zfp709	A	T	8: 71,890,662	Y645F	probably damaging	Het
Zmym2	T	A	14: 56,913,091	C424S	probably damaging	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
tintoretto	UTSW	5	72609500	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
R7922:Cnga1	UTSW	5	72604882	missense	possibly damaging	0.81
R7938:Cnga1	UTSW	5	72604254	missense	probably benign	0.27
R7994:Cnga1	UTSW	5	72604660	missense	probably damaging	1.00
R8249:Cnga1	UTSW	5	72605394	missense	probably benign	0.02
R8690:Cnga1	UTSW	5	72604492	missense	probably benign	0.15
R9689:Cnga1	UTSW	5	72604827	missense	probably benign	0.10
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00
Z1177:Cnga1	UTSW	5	72605530	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGATCCTTGGAGCCCAGTGATTC -3'
(R):5'- AGCCAGACGTTGCATCAATGCC -3'

Sequencing Primer
(F):5'- TGGAGCCCAGTGATTCTTAAC -3'
(R):5'- ACGTTGCATCAATGCCTCTTTATG -3'

Posted On

2014-03-14