Mutagenetix > Incidental Mutation

Incidental Mutation 'R1386:Ttc28'

160578

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

039448-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1386 (G1)

Quality Score

185

Status

Not validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111225677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 962 (S962N)

Ref Sequence

ENSEMBL: ENSMUSP00000137609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

AlphaFold

Q80XJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000040111
AA Change: S993N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: S993N

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125470

Predicted Effect

probably damaging
Transcript: ENSMUST00000156290
AA Change: S962N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: S962N

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Meta Mutation Damage Score

0.0827

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.5%
20x: 87.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,244,255	I235V	probably benign	Het
Acsm4	T	C	7: 119,698,578	I146T	probably benign	Het
Adgrv1	T	C	13: 81,528,865	N1949S	probably benign	Het
Afdn	T	C	17: 13,846,536	V630A	probably damaging	Het
Amfr	A	G	8: 93,985,399	V301A	possibly damaging	Het
Anapc16	T	C	10: 59,996,457	M45V	probably benign	Het
Ankrd12	T	C	17: 65,983,380	E1686G	possibly damaging	Het
Ap2m1	T	G	16: 20,541,229	H193Q	probably damaging	Het
Aplnr	T	C	2: 85,137,461	W277R	possibly damaging	Het
Aspm	A	G	1: 139,457,623	E335G	probably benign	Het
Aspm	C	T	1: 139,478,972	H1866Y	possibly damaging	Het
Atp8b4	T	A	2: 126,378,744	D578V	probably benign	Het
Ccr1	T	A	9: 123,963,962	E177V	probably benign	Het
Cecr2	A	G	6: 120,762,131	E1245G	probably damaging	Het
Cep162	A	T	9: 87,221,202	C638S	probably benign	Het
Ces1b	A	T	8: 93,068,077	I298N	probably benign	Het
Chdh	T	A	14: 30,031,434	L100Q	probably damaging	Het
Chrnd	T	C	1: 87,192,590	I156T	probably damaging	Het
Clpx	G	A	9: 65,326,888	R605Q	probably null	Het
Cnga1	T	A	5: 72,612,183	K135*	probably null	Het
Col6a4	A	T	9: 106,062,945	V1262E	probably benign	Het
Cracr2b	T	C	7: 141,463,568	L53P	probably damaging	Het
Crhr1	T	C	11: 104,174,394	S372P	possibly damaging	Het
Cyp11b2	T	A	15: 74,851,775		probably null	Het
Cyp21a1	T	A	17: 34,802,210	D373V	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddah1	A	T	3: 145,889,211	Y242F	probably benign	Het
Dlgap3	A	G	4: 127,194,926	D105G	possibly damaging	Het
Dtl	A	G	1: 191,569,717	V76A	probably damaging	Het
Dzank1	A	G	2: 144,491,831	S361P	probably benign	Het
Ehd3	T	A	17: 73,820,543	I157N	probably damaging	Het
Elk4	T	C	1: 132,017,830	F149L	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam83a	A	G	15: 57,986,503	R148G	probably damaging	Het
Farp2	C	A	1: 93,620,151		probably null	Het
Fbxw25	T	A	9: 109,654,641	I168F	possibly damaging	Het
Fermt1	T	C	2: 132,916,058	D479G	probably damaging	Het
Fgf17	C	A	14: 70,636,770	R193L	probably damaging	Het
Foxred2	T	G	15: 77,948,521		probably null	Het
Gad1	T	C	2: 70,574,123	V119A	possibly damaging	Het
Gas2l3	A	G	10: 89,414,353	V301A	possibly damaging	Het
Gimap8	G	A	6: 48,656,653	V469I	probably benign	Het
Gja1	A	T	10: 56,387,969	E141D	probably benign	Het
Glod4	C	T	11: 76,222,003	W268*	probably null	Het
Gm7173	C	T	X: 79,509,901	V323I	possibly damaging	Het
Guf1	C	T	5: 69,563,162	H309Y	probably benign	Het
Hax1	A	G	3: 89,995,849	V215A	probably damaging	Het
Heatr9	T	C	11: 83,518,825	D107G	probably benign	Het
Hephl1	T	A	9: 15,076,754	Y686F	probably benign	Het
Hk3	T	C	13: 55,007,030		probably null	Het
Ikbkb	G	T	8: 22,665,617	Q620K	possibly damaging	Het
Il18rap	C	T	1: 40,531,522	A208V	probably benign	Het
Kif26b	T	C	1: 178,915,644	S1102P	probably benign	Het
Kif5b	A	T	18: 6,226,383	D147E	probably damaging	Het
Klhl3	T	C	13: 58,030,433	T348A	probably damaging	Het
Krt10	T	C	11: 99,385,920		probably benign	Het
Lama3	A	T	18: 12,477,370	H1124L	probably benign	Het
Lin7a	A	T	10: 107,412,122	Q96L	unknown	Het
Ly6c2	T	G	15: 75,110,589	I37L	probably benign	Het
Mov10l1	A	G	15: 89,011,386	Y585C	possibly damaging	Het
Msr1	G	A	8: 39,589,293	Q414*	probably null	Het
Myh13	T	C	11: 67,370,950	C1900R	possibly damaging	Het
Obscn	T	A	11: 59,133,853	N454Y	probably damaging	Het
Olfml2b	T	G	1: 170,681,162	Y530D	probably damaging	Het
Olfr1057	A	G	2: 86,374,921	F164L	probably damaging	Het
Olfr1206	T	A	2: 88,865,353	F249L	probably benign	Het
Olfr1377	T	C	11: 50,985,367	F222S	probably damaging	Het
Olfr1449	A	T	19: 12,935,139	T134S	probably benign	Het
Olfr591	T	A	7: 103,173,367	H90L	probably benign	Het
Olfr868	T	A	9: 20,101,582	N274K	probably benign	Het
Pde10a	T	G	17: 8,953,742	V648G	probably damaging	Het
Pde7b	T	A	10: 20,418,801	H258L	probably damaging	Het
Pik3cb	A	G	9: 99,064,027	V582A	possibly damaging	Het
Plxnb1	T	C	9: 109,101,023	S316P	probably benign	Het
Pmpca	C	T	2: 26,392,518	T246I	probably damaging	Het
Reep3	A	T	10: 67,063,009	V32D	possibly damaging	Het
Rfx4	A	G	10: 84,863,285	M252V	probably damaging	Het
Rnf168	C	A	16: 32,298,963	D447E	probably damaging	Het
Rnf31	T	C	14: 55,596,764	V518A	probably damaging	Het
Rnpc3	A	T	3: 113,613,784	L340*	probably null	Het
Scn2a	A	G	2: 65,688,741	E437G	probably damaging	Het
Scnn1b	C	A	7: 121,902,488	N175K	possibly damaging	Het
Slc39a11	T	A	11: 113,247,724	I344F	probably benign	Het
Slc9a2	T	A	1: 40,719,018	L239Q	probably damaging	Het
Smg5	T	C	3: 88,355,671	F794L	probably damaging	Het
Smim13	C	T	13: 41,272,692	S68L	possibly damaging	Het
Sos2	A	T	12: 69,614,658	Y680N	probably damaging	Het
Spag6	T	A	2: 18,734,246	M329K	possibly damaging	Het
Spire2	G	A	8: 123,361,366		probably null	Het
Tdrd9	T	A	12: 112,044,804	V1149D	probably benign	Het
Tns3	T	A	11: 8,518,261	Y321F	probably benign	Het
Top3b	T	C	16: 16,880,629	V112A	probably benign	Het
Trafd1	G	A	5: 121,379,652	T26I	probably damaging	Het
Vmn2r78	T	C	7: 86,915,407	L20S	unknown	Het
Vmn2r82	A	T	10: 79,378,711	D176V	probably damaging	Het
Vps13b	T	C	15: 35,923,312	F3778L	probably damaging	Het
Vwa3b	T	C	1: 37,051,881		probably null	Het
Vwc2	C	T	11: 11,154,262	P265S	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zfp335	T	C	2: 164,898,241	T764A	probably benign	Het
Zfp366	T	A	13: 99,246,555	V742D	probably damaging	Het
Zfp709	A	T	8: 71,890,662	Y645F	probably damaging	Het
Zmym2	T	A	14: 56,913,091	C424S	probably damaging	Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0582:Ttc28	UTSW	5	111183296	missense	probably damaging	1.00
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4840:Ttc28	UTSW	5	111286081	missense	probably damaging	1.00
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5851:Ttc28	UTSW	5	111235469	splice site	probably benign
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7350:Ttc28	UTSW	5	111226037	missense	probably damaging	0.97
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8247:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
R8346:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8356:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8423:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8424:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8426:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8441:Ttc28	UTSW	5	111177641	nonsense	probably null
R8494:Ttc28	UTSW	5	111235640	missense	probably damaging	0.96
R8508:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8510:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8729:Ttc28	UTSW	5	111235643	critical splice donor site	probably null
R8845:Ttc28	UTSW	5	111224175	missense	probably benign	0.11
R9003:Ttc28	UTSW	5	111277030	missense	probably benign	0.00
R9185:Ttc28	UTSW	5	111223476	missense	probably benign	0.03
R9187:Ttc28	UTSW	5	111102036	missense	probably damaging	1.00
R9245:Ttc28	UTSW	5	111177659	missense	unknown
R9251:Ttc28	UTSW	5	110892832	missense	possibly damaging	0.47
R9372:Ttc28	UTSW	5	111183207	missense	probably benign	0.25
R9466:Ttc28	UTSW	5	111183029	missense	probably damaging	0.99
R9563:Ttc28	UTSW	5	111223226	missense	probably benign	0.22
R9606:Ttc28	UTSW	5	111285274	missense	probably benign	0.00
R9691:Ttc28	UTSW	5	111284013	missense	probably benign	0.01
R9709:Ttc28	UTSW	5	111285771	missense	probably damaging	0.97
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCACCTGCACAGAGTGATCTCATTG -3'
(R):5'- TGATAGACCACAGCCCTCTCGAAG -3'

Sequencing Primer
(F):5'- AGAGTGATCTCATTGCTTCTCTG -3'
(R):5'- ACTCGTAGGTGAGTCCCAG -3'

Posted On

2014-03-14