Incidental Mutation 'R1386:Or52s1b'
ID 160587
Institutional Source Beutler Lab
Gene Symbol Or52s1b
Ensembl Gene ENSMUSG00000057461
Gene Name olfactory receptor family 52 subfamily S member 1B
Synonyms MOR24-1P, GA_x6K02T2PBJ9-5889409-5888465, Olfr591
MMRRC Submission 039448-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R1386 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102821898-102822842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102822574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 90 (H90L)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
AlphaFold Q7TRR7
Predicted Effect probably benign
Transcript: ENSMUST00000074272
AA Change: H90L

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: H90L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216581
AA Change: H90L

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,135,081 (GRCm39) I235V probably benign Het
Acsm4 T C 7: 119,297,801 (GRCm39) I146T probably benign Het
Adgrv1 T C 13: 81,676,984 (GRCm39) N1949S probably benign Het
Afdn T C 17: 14,066,798 (GRCm39) V630A probably damaging Het
Amfr A G 8: 94,712,027 (GRCm39) V301A possibly damaging Het
Anapc16 T C 10: 59,832,279 (GRCm39) M45V probably benign Het
Ankrd12 T C 17: 66,290,375 (GRCm39) E1686G possibly damaging Het
Ap2m1 T G 16: 20,359,979 (GRCm39) H193Q probably damaging Het
Aplnr T C 2: 84,967,805 (GRCm39) W277R possibly damaging Het
Aspm C T 1: 139,406,710 (GRCm39) H1866Y possibly damaging Het
Aspm A G 1: 139,385,361 (GRCm39) E335G probably benign Het
Atp8b4 T A 2: 126,220,664 (GRCm39) D578V probably benign Het
Ccr1 T A 9: 123,763,999 (GRCm39) E177V probably benign Het
Cecr2 A G 6: 120,739,092 (GRCm39) E1245G probably damaging Het
Cep162 A T 9: 87,103,255 (GRCm39) C638S probably benign Het
Ces1b A T 8: 93,794,705 (GRCm39) I298N probably benign Het
Cfap47 C T X: 78,553,507 (GRCm39) V323I possibly damaging Het
Chdh T A 14: 29,753,391 (GRCm39) L100Q probably damaging Het
Chrnd T C 1: 87,120,312 (GRCm39) I156T probably damaging Het
Clpx G A 9: 65,234,170 (GRCm39) R605Q probably null Het
Cnga1 T A 5: 72,769,526 (GRCm39) K135* probably null Het
Col6a4 A T 9: 105,940,144 (GRCm39) V1262E probably benign Het
Cracr2b T C 7: 141,043,481 (GRCm39) L53P probably damaging Het
Crhr1 T C 11: 104,065,220 (GRCm39) S372P possibly damaging Het
Cyp11b2 T A 15: 74,723,624 (GRCm39) probably null Het
Cyp21a1 T A 17: 35,021,184 (GRCm39) D373V probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Ddah1 A T 3: 145,594,966 (GRCm39) Y242F probably benign Het
Dlgap3 A G 4: 127,088,719 (GRCm39) D105G possibly damaging Het
Dtl A G 1: 191,301,829 (GRCm39) V76A probably damaging Het
Dzank1 A G 2: 144,333,751 (GRCm39) S361P probably benign Het
Ehd3 T A 17: 74,127,538 (GRCm39) I157N probably damaging Het
Elk4 T C 1: 131,945,568 (GRCm39) F149L probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fam83a A G 15: 57,849,899 (GRCm39) R148G probably damaging Het
Farp2 C A 1: 93,547,873 (GRCm39) probably null Het
Fbxw25 T A 9: 109,483,709 (GRCm39) I168F possibly damaging Het
Fermt1 T C 2: 132,757,978 (GRCm39) D479G probably damaging Het
Fgf17 C A 14: 70,874,210 (GRCm39) R193L probably damaging Het
Foxred2 T G 15: 77,832,721 (GRCm39) probably null Het
Gad1 T C 2: 70,404,467 (GRCm39) V119A possibly damaging Het
Gas2l3 A G 10: 89,250,215 (GRCm39) V301A possibly damaging Het
Gimap8 G A 6: 48,633,587 (GRCm39) V469I probably benign Het
Gja1 A T 10: 56,264,065 (GRCm39) E141D probably benign Het
Glod4 C T 11: 76,112,829 (GRCm39) W268* probably null Het
Guf1 C T 5: 69,720,505 (GRCm39) H309Y probably benign Het
Hax1 A G 3: 89,903,156 (GRCm39) V215A probably damaging Het
Heatr9 T C 11: 83,409,651 (GRCm39) D107G probably benign Het
Hephl1 T A 9: 14,988,050 (GRCm39) Y686F probably benign Het
Hk3 T C 13: 55,154,843 (GRCm39) probably null Het
Ikbkb G T 8: 23,155,633 (GRCm39) Q620K possibly damaging Het
Il18rap C T 1: 40,570,682 (GRCm39) A208V probably benign Het
Kif26b T C 1: 178,743,209 (GRCm39) S1102P probably benign Het
Kif5b A T 18: 6,226,383 (GRCm39) D147E probably damaging Het
Klhl3 T C 13: 58,178,247 (GRCm39) T348A probably damaging Het
Krt10 T C 11: 99,276,746 (GRCm39) probably benign Het
Lama3 A T 18: 12,610,427 (GRCm39) H1124L probably benign Het
Lin7a A T 10: 107,247,983 (GRCm39) Q96L unknown Het
Ly6c2 T G 15: 74,982,438 (GRCm39) I37L probably benign Het
Mov10l1 A G 15: 88,895,589 (GRCm39) Y585C possibly damaging Het
Msr1 G A 8: 40,042,334 (GRCm39) Q414* probably null Het
Myh13 T C 11: 67,261,776 (GRCm39) C1900R possibly damaging Het
Obscn T A 11: 59,024,679 (GRCm39) N454Y probably damaging Het
Olfml2b T G 1: 170,508,731 (GRCm39) Y530D probably damaging Het
Or1ad1 T C 11: 50,876,194 (GRCm39) F222S probably damaging Het
Or4c11 T A 2: 88,695,697 (GRCm39) F249L probably benign Het
Or5b24 A T 19: 12,912,503 (GRCm39) T134S probably benign Het
Or7e174 T A 9: 20,012,878 (GRCm39) N274K probably benign Het
Or8j3b A G 2: 86,205,265 (GRCm39) F164L probably damaging Het
Pde10a T G 17: 9,172,574 (GRCm39) V648G probably damaging Het
Pde7b T A 10: 20,294,547 (GRCm39) H258L probably damaging Het
Pik3cb A G 9: 98,946,080 (GRCm39) V582A possibly damaging Het
Plxnb1 T C 9: 108,930,091 (GRCm39) S316P probably benign Het
Pmpca C T 2: 26,282,530 (GRCm39) T246I probably damaging Het
Reep3 A T 10: 66,898,788 (GRCm39) V32D possibly damaging Het
Rfx4 A G 10: 84,699,149 (GRCm39) M252V probably damaging Het
Rnf168 C A 16: 32,117,781 (GRCm39) D447E probably damaging Het
Rnf31 T C 14: 55,834,221 (GRCm39) V518A probably damaging Het
Rnpc3 A T 3: 113,407,433 (GRCm39) L340* probably null Het
Scn2a A G 2: 65,519,085 (GRCm39) E437G probably damaging Het
Scnn1b C A 7: 121,501,711 (GRCm39) N175K possibly damaging Het
Slc39a11 T A 11: 113,138,550 (GRCm39) I344F probably benign Het
Slc9a2 T A 1: 40,758,178 (GRCm39) L239Q probably damaging Het
Smg5 T C 3: 88,262,978 (GRCm39) F794L probably damaging Het
Smim13 C T 13: 41,426,168 (GRCm39) S68L possibly damaging Het
Sos2 A T 12: 69,661,432 (GRCm39) Y680N probably damaging Het
Spag6 T A 2: 18,739,057 (GRCm39) M329K possibly damaging Het
Spire2 G A 8: 124,088,105 (GRCm39) probably null Het
Tdrd9 T A 12: 112,011,238 (GRCm39) V1149D probably benign Het
Tns3 T A 11: 8,468,261 (GRCm39) Y321F probably benign Het
Top3b T C 16: 16,698,493 (GRCm39) V112A probably benign Het
Trafd1 G A 5: 121,517,715 (GRCm39) T26I probably damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Vmn2r78 T C 7: 86,564,615 (GRCm39) L20S unknown Het
Vmn2r82 A T 10: 79,214,545 (GRCm39) D176V probably damaging Het
Vps13b T C 15: 35,923,458 (GRCm39) F3778L probably damaging Het
Vwa3b T C 1: 37,090,962 (GRCm39) probably null Het
Vwc2 C T 11: 11,104,262 (GRCm39) P265S probably damaging Het
Zbtb9 T A 17: 27,193,612 (GRCm39) I339N probably damaging Het
Zfp335 T C 2: 164,740,161 (GRCm39) T764A probably benign Het
Zfp366 T A 13: 99,383,063 (GRCm39) V742D probably damaging Het
Zfp709 A T 8: 72,644,506 (GRCm39) Y645F probably damaging Het
Zmym2 T A 14: 57,150,548 (GRCm39) C424S probably damaging Het
Other mutations in Or52s1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Or52s1b APN 7 102,822,658 (GRCm39) missense probably damaging 1.00
IGL03307:Or52s1b APN 7 102,822,623 (GRCm39) missense probably benign 0.00
G1Funyon:Or52s1b UTSW 7 102,822,280 (GRCm39) missense probably damaging 0.99
R0082:Or52s1b UTSW 7 102,822,409 (GRCm39) missense probably benign 0.05
R0389:Or52s1b UTSW 7 102,822,490 (GRCm39) missense possibly damaging 0.48
R0843:Or52s1b UTSW 7 102,822,326 (GRCm39) missense possibly damaging 0.74
R1378:Or52s1b UTSW 7 102,822,475 (GRCm39) missense probably damaging 1.00
R1521:Or52s1b UTSW 7 102,822,658 (GRCm39) missense probably benign 0.39
R1538:Or52s1b UTSW 7 102,822,193 (GRCm39) missense probably damaging 0.97
R3108:Or52s1b UTSW 7 102,822,293 (GRCm39) missense probably damaging 0.98
R3109:Or52s1b UTSW 7 102,822,293 (GRCm39) missense probably damaging 0.98
R5350:Or52s1b UTSW 7 102,822,766 (GRCm39) missense probably damaging 0.99
R5488:Or52s1b UTSW 7 102,822,658 (GRCm39) missense probably damaging 1.00
R5489:Or52s1b UTSW 7 102,822,658 (GRCm39) missense probably damaging 1.00
R5598:Or52s1b UTSW 7 102,822,841 (GRCm39) start codon destroyed probably null 1.00
R5607:Or52s1b UTSW 7 102,822,056 (GRCm39) missense probably damaging 0.96
R5608:Or52s1b UTSW 7 102,822,056 (GRCm39) missense probably damaging 0.96
R6974:Or52s1b UTSW 7 102,822,442 (GRCm39) missense probably damaging 0.99
R6994:Or52s1b UTSW 7 102,822,119 (GRCm39) missense probably damaging 1.00
R7095:Or52s1b UTSW 7 102,822,253 (GRCm39) missense probably benign 0.00
R7966:Or52s1b UTSW 7 102,822,062 (GRCm39) missense probably damaging 0.99
R7980:Or52s1b UTSW 7 102,822,242 (GRCm39) missense probably damaging 1.00
R8301:Or52s1b UTSW 7 102,822,280 (GRCm39) missense probably damaging 0.99
R8831:Or52s1b UTSW 7 102,822,203 (GRCm39) missense probably benign 0.01
Z1088:Or52s1b UTSW 7 102,822,013 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCAATCTTGATGAGGGCCATGAAC -3'
(R):5'- ATTCCTGGGTTGGAGGCAGCAC -3'

Sequencing Primer
(F):5'- TTAGAAAGGCTGCTCCACG -3'
(R):5'- ACATGTGGATTTCCATCCCTTTTTG -3'
Posted On 2014-03-14