Incidental Mutation 'R1386:Cracr2b'
ID 160591
Institutional Source Beutler Lab
Gene Symbol Cracr2b
Ensembl Gene ENSMUSG00000048200
Gene Name calcium release activated channel regulator 2B
Synonyms Efcab4a, 6330520A15Rik
MMRRC Submission 039448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R1386 (G1)
Quality Score 108
Status Not validated
Chromosome 7
Chromosomal Location 141461094-141466613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141463568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 53 (L53P)
Ref Sequence ENSEMBL: ENSMUSP00000132793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000064151] [ENSMUST00000106000] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000167491] [ENSMUST00000170879] [ENSMUST00000172215] [ENSMUST00000209988] [ENSMUST00000209892] [ENSMUST00000211071] [ENSMUST00000177840] [ENSMUST00000169665]
AlphaFold Q80ZJ8
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053670
AA Change: L53P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064151
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect probably benign
Transcript: ENSMUST00000106000
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163833
Predicted Effect probably benign
Transcript: ENSMUST00000164016
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably damaging
Transcript: ENSMUST00000167491
AA Change: L53P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably damaging
Transcript: ENSMUST00000170879
AA Change: L53P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172215
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132793
Gene: ENSMUSG00000048200
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209698
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171994
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211564
Predicted Effect probably benign
Transcript: ENSMUST00000177840
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169665
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169723
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,244,255 I235V probably benign Het
Acsm4 T C 7: 119,698,578 I146T probably benign Het
Adgrv1 T C 13: 81,528,865 N1949S probably benign Het
Afdn T C 17: 13,846,536 V630A probably damaging Het
Amfr A G 8: 93,985,399 V301A possibly damaging Het
Anapc16 T C 10: 59,996,457 M45V probably benign Het
Ankrd12 T C 17: 65,983,380 E1686G possibly damaging Het
Ap2m1 T G 16: 20,541,229 H193Q probably damaging Het
Aplnr T C 2: 85,137,461 W277R possibly damaging Het
Aspm A G 1: 139,457,623 E335G probably benign Het
Aspm C T 1: 139,478,972 H1866Y possibly damaging Het
Atp8b4 T A 2: 126,378,744 D578V probably benign Het
Ccr1 T A 9: 123,963,962 E177V probably benign Het
Cecr2 A G 6: 120,762,131 E1245G probably damaging Het
Cep162 A T 9: 87,221,202 C638S probably benign Het
Ces1b A T 8: 93,068,077 I298N probably benign Het
Chdh T A 14: 30,031,434 L100Q probably damaging Het
Chrnd T C 1: 87,192,590 I156T probably damaging Het
Clpx G A 9: 65,326,888 R605Q probably null Het
Cnga1 T A 5: 72,612,183 K135* probably null Het
Col6a4 A T 9: 106,062,945 V1262E probably benign Het
Crhr1 T C 11: 104,174,394 S372P possibly damaging Het
Cyp11b2 T A 15: 74,851,775 probably null Het
Cyp21a1 T A 17: 34,802,210 D373V probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah1 A T 3: 145,889,211 Y242F probably benign Het
Dlgap3 A G 4: 127,194,926 D105G possibly damaging Het
Dtl A G 1: 191,569,717 V76A probably damaging Het
Dzank1 A G 2: 144,491,831 S361P probably benign Het
Ehd3 T A 17: 73,820,543 I157N probably damaging Het
Elk4 T C 1: 132,017,830 F149L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83a A G 15: 57,986,503 R148G probably damaging Het
Farp2 C A 1: 93,620,151 probably null Het
Fbxw25 T A 9: 109,654,641 I168F possibly damaging Het
Fermt1 T C 2: 132,916,058 D479G probably damaging Het
Fgf17 C A 14: 70,636,770 R193L probably damaging Het
Foxred2 T G 15: 77,948,521 probably null Het
Gad1 T C 2: 70,574,123 V119A possibly damaging Het
Gas2l3 A G 10: 89,414,353 V301A possibly damaging Het
Gimap8 G A 6: 48,656,653 V469I probably benign Het
Gja1 A T 10: 56,387,969 E141D probably benign Het
Glod4 C T 11: 76,222,003 W268* probably null Het
Gm7173 C T X: 79,509,901 V323I possibly damaging Het
Guf1 C T 5: 69,563,162 H309Y probably benign Het
Hax1 A G 3: 89,995,849 V215A probably damaging Het
Heatr9 T C 11: 83,518,825 D107G probably benign Het
Hephl1 T A 9: 15,076,754 Y686F probably benign Het
Hk3 T C 13: 55,007,030 probably null Het
Ikbkb G T 8: 22,665,617 Q620K possibly damaging Het
Il18rap C T 1: 40,531,522 A208V probably benign Het
Kif26b T C 1: 178,915,644 S1102P probably benign Het
Kif5b A T 18: 6,226,383 D147E probably damaging Het
Klhl3 T C 13: 58,030,433 T348A probably damaging Het
Krt10 T C 11: 99,385,920 probably benign Het
Lama3 A T 18: 12,477,370 H1124L probably benign Het
Lin7a A T 10: 107,412,122 Q96L unknown Het
Ly6c2 T G 15: 75,110,589 I37L probably benign Het
Mov10l1 A G 15: 89,011,386 Y585C possibly damaging Het
Msr1 G A 8: 39,589,293 Q414* probably null Het
Myh13 T C 11: 67,370,950 C1900R possibly damaging Het
Obscn T A 11: 59,133,853 N454Y probably damaging Het
Olfml2b T G 1: 170,681,162 Y530D probably damaging Het
Olfr1057 A G 2: 86,374,921 F164L probably damaging Het
Olfr1206 T A 2: 88,865,353 F249L probably benign Het
Olfr1377 T C 11: 50,985,367 F222S probably damaging Het
Olfr1449 A T 19: 12,935,139 T134S probably benign Het
Olfr591 T A 7: 103,173,367 H90L probably benign Het
Olfr868 T A 9: 20,101,582 N274K probably benign Het
Pde10a T G 17: 8,953,742 V648G probably damaging Het
Pde7b T A 10: 20,418,801 H258L probably damaging Het
Pik3cb A G 9: 99,064,027 V582A possibly damaging Het
Plxnb1 T C 9: 109,101,023 S316P probably benign Het
Pmpca C T 2: 26,392,518 T246I probably damaging Het
Reep3 A T 10: 67,063,009 V32D possibly damaging Het
Rfx4 A G 10: 84,863,285 M252V probably damaging Het
Rnf168 C A 16: 32,298,963 D447E probably damaging Het
Rnf31 T C 14: 55,596,764 V518A probably damaging Het
Rnpc3 A T 3: 113,613,784 L340* probably null Het
Scn2a A G 2: 65,688,741 E437G probably damaging Het
Scnn1b C A 7: 121,902,488 N175K possibly damaging Het
Slc39a11 T A 11: 113,247,724 I344F probably benign Het
Slc9a2 T A 1: 40,719,018 L239Q probably damaging Het
Smg5 T C 3: 88,355,671 F794L probably damaging Het
Smim13 C T 13: 41,272,692 S68L possibly damaging Het
Sos2 A T 12: 69,614,658 Y680N probably damaging Het
Spag6 T A 2: 18,734,246 M329K possibly damaging Het
Spire2 G A 8: 123,361,366 probably null Het
Tdrd9 T A 12: 112,044,804 V1149D probably benign Het
Tns3 T A 11: 8,518,261 Y321F probably benign Het
Top3b T C 16: 16,880,629 V112A probably benign Het
Trafd1 G A 5: 121,379,652 T26I probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vmn2r78 T C 7: 86,915,407 L20S unknown Het
Vmn2r82 A T 10: 79,378,711 D176V probably damaging Het
Vps13b T C 15: 35,923,312 F3778L probably damaging Het
Vwa3b T C 1: 37,051,881 probably null Het
Vwc2 C T 11: 11,154,262 P265S probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp335 T C 2: 164,898,241 T764A probably benign Het
Zfp366 T A 13: 99,246,555 V742D probably damaging Het
Zfp709 A T 8: 71,890,662 Y645F probably damaging Het
Zmym2 T A 14: 56,913,091 C424S probably damaging Het
Other mutations in Cracr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cracr2b APN 7 141465757 unclassified probably benign
IGL02092:Cracr2b APN 7 141464956 missense probably damaging 0.96
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0324:Cracr2b UTSW 7 141463746 missense probably damaging 1.00
R0453:Cracr2b UTSW 7 141464263 missense probably damaging 0.96
R0569:Cracr2b UTSW 7 141464935 unclassified probably benign
R2061:Cracr2b UTSW 7 141465280 missense probably damaging 0.96
R3605:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R3607:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R4674:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R4675:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R5401:Cracr2b UTSW 7 141466223 makesense probably null
R6174:Cracr2b UTSW 7 141464836 missense probably damaging 1.00
R7127:Cracr2b UTSW 7 141465782 missense possibly damaging 0.73
R7132:Cracr2b UTSW 7 141463738 missense probably benign 0.30
R7303:Cracr2b UTSW 7 141463202 unclassified probably benign
R7448:Cracr2b UTSW 7 141464205 missense probably benign 0.26
R7965:Cracr2b UTSW 7 141464248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCATGCCATCGCAGTGAC -3'
(R):5'- GGGCCTGGTCCAGACTTTCAAATAC -3'

Sequencing Primer
(F):5'- ATCGCAGTGACCCTGGAG -3'
(R):5'- GTCCAGACTTTCAAATACAGCCTC -3'
Posted On 2014-03-14