Incidental Mutation 'R1386:Col6a4'
ID 160604
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Name collagen, type VI, alpha 4
Synonyms Vwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 039448-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1386 (G1)
Quality Score 188
Status Not validated
Chromosome 9
Chromosomal Location 105989454-106096783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106062945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1262 (V1262E)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
AlphaFold A2AX52
Predicted Effect probably benign
Transcript: ENSMUST00000121963
AA Change: V1262E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: V1262E

signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,244,255 I235V probably benign Het
Acsm4 T C 7: 119,698,578 I146T probably benign Het
Adgrv1 T C 13: 81,528,865 N1949S probably benign Het
Afdn T C 17: 13,846,536 V630A probably damaging Het
Amfr A G 8: 93,985,399 V301A possibly damaging Het
Anapc16 T C 10: 59,996,457 M45V probably benign Het
Ankrd12 T C 17: 65,983,380 E1686G possibly damaging Het
Ap2m1 T G 16: 20,541,229 H193Q probably damaging Het
Aplnr T C 2: 85,137,461 W277R possibly damaging Het
Aspm A G 1: 139,457,623 E335G probably benign Het
Aspm C T 1: 139,478,972 H1866Y possibly damaging Het
Atp8b4 T A 2: 126,378,744 D578V probably benign Het
Ccr1 T A 9: 123,963,962 E177V probably benign Het
Cecr2 A G 6: 120,762,131 E1245G probably damaging Het
Cep162 A T 9: 87,221,202 C638S probably benign Het
Ces1b A T 8: 93,068,077 I298N probably benign Het
Chdh T A 14: 30,031,434 L100Q probably damaging Het
Chrnd T C 1: 87,192,590 I156T probably damaging Het
Clpx G A 9: 65,326,888 R605Q probably null Het
Cnga1 T A 5: 72,612,183 K135* probably null Het
Cracr2b T C 7: 141,463,568 L53P probably damaging Het
Crhr1 T C 11: 104,174,394 S372P possibly damaging Het
Cyp11b2 T A 15: 74,851,775 probably null Het
Cyp21a1 T A 17: 34,802,210 D373V probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah1 A T 3: 145,889,211 Y242F probably benign Het
Dlgap3 A G 4: 127,194,926 D105G possibly damaging Het
Dtl A G 1: 191,569,717 V76A probably damaging Het
Dzank1 A G 2: 144,491,831 S361P probably benign Het
Ehd3 T A 17: 73,820,543 I157N probably damaging Het
Elk4 T C 1: 132,017,830 F149L probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83a A G 15: 57,986,503 R148G probably damaging Het
Farp2 C A 1: 93,620,151 probably null Het
Fbxw25 T A 9: 109,654,641 I168F possibly damaging Het
Fermt1 T C 2: 132,916,058 D479G probably damaging Het
Fgf17 C A 14: 70,636,770 R193L probably damaging Het
Foxred2 T G 15: 77,948,521 probably null Het
Gad1 T C 2: 70,574,123 V119A possibly damaging Het
Gas2l3 A G 10: 89,414,353 V301A possibly damaging Het
Gimap8 G A 6: 48,656,653 V469I probably benign Het
Gja1 A T 10: 56,387,969 E141D probably benign Het
Glod4 C T 11: 76,222,003 W268* probably null Het
Gm7173 C T X: 79,509,901 V323I possibly damaging Het
Guf1 C T 5: 69,563,162 H309Y probably benign Het
Hax1 A G 3: 89,995,849 V215A probably damaging Het
Heatr9 T C 11: 83,518,825 D107G probably benign Het
Hephl1 T A 9: 15,076,754 Y686F probably benign Het
Hk3 T C 13: 55,007,030 probably null Het
Ikbkb G T 8: 22,665,617 Q620K possibly damaging Het
Il18rap C T 1: 40,531,522 A208V probably benign Het
Kif26b T C 1: 178,915,644 S1102P probably benign Het
Kif5b A T 18: 6,226,383 D147E probably damaging Het
Klhl3 T C 13: 58,030,433 T348A probably damaging Het
Krt10 T C 11: 99,385,920 probably benign Het
Lama3 A T 18: 12,477,370 H1124L probably benign Het
Lin7a A T 10: 107,412,122 Q96L unknown Het
Ly6c2 T G 15: 75,110,589 I37L probably benign Het
Mov10l1 A G 15: 89,011,386 Y585C possibly damaging Het
Msr1 G A 8: 39,589,293 Q414* probably null Het
Myh13 T C 11: 67,370,950 C1900R possibly damaging Het
Obscn T A 11: 59,133,853 N454Y probably damaging Het
Olfml2b T G 1: 170,681,162 Y530D probably damaging Het
Olfr1057 A G 2: 86,374,921 F164L probably damaging Het
Olfr1206 T A 2: 88,865,353 F249L probably benign Het
Olfr1377 T C 11: 50,985,367 F222S probably damaging Het
Olfr1449 A T 19: 12,935,139 T134S probably benign Het
Olfr591 T A 7: 103,173,367 H90L probably benign Het
Olfr868 T A 9: 20,101,582 N274K probably benign Het
Pde10a T G 17: 8,953,742 V648G probably damaging Het
Pde7b T A 10: 20,418,801 H258L probably damaging Het
Pik3cb A G 9: 99,064,027 V582A possibly damaging Het
Plxnb1 T C 9: 109,101,023 S316P probably benign Het
Pmpca C T 2: 26,392,518 T246I probably damaging Het
Reep3 A T 10: 67,063,009 V32D possibly damaging Het
Rfx4 A G 10: 84,863,285 M252V probably damaging Het
Rnf168 C A 16: 32,298,963 D447E probably damaging Het
Rnf31 T C 14: 55,596,764 V518A probably damaging Het
Rnpc3 A T 3: 113,613,784 L340* probably null Het
Scn2a A G 2: 65,688,741 E437G probably damaging Het
Scnn1b C A 7: 121,902,488 N175K possibly damaging Het
Slc39a11 T A 11: 113,247,724 I344F probably benign Het
Slc9a2 T A 1: 40,719,018 L239Q probably damaging Het
Smg5 T C 3: 88,355,671 F794L probably damaging Het
Smim13 C T 13: 41,272,692 S68L possibly damaging Het
Sos2 A T 12: 69,614,658 Y680N probably damaging Het
Spag6 T A 2: 18,734,246 M329K possibly damaging Het
Spire2 G A 8: 123,361,366 probably null Het
Tdrd9 T A 12: 112,044,804 V1149D probably benign Het
Tns3 T A 11: 8,518,261 Y321F probably benign Het
Top3b T C 16: 16,880,629 V112A probably benign Het
Trafd1 G A 5: 121,379,652 T26I probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vmn2r78 T C 7: 86,915,407 L20S unknown Het
Vmn2r82 A T 10: 79,378,711 D176V probably damaging Het
Vps13b T C 15: 35,923,312 F3778L probably damaging Het
Vwa3b T C 1: 37,051,881 probably null Het
Vwc2 C T 11: 11,154,262 P265S probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zfp335 T C 2: 164,898,241 T764A probably benign Het
Zfp366 T A 13: 99,246,555 V742D probably damaging Het
Zfp709 A T 8: 71,890,662 Y645F probably damaging Het
Zmym2 T A 14: 56,913,091 C424S probably damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8309:Col6a4 UTSW 9 106075215 missense probably benign 0.08
R8336:Col6a4 UTSW 9 106075329 missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 106068384 missense probably benign 0.00
R8530:Col6a4 UTSW 9 106080505 missense probably benign 0.31
R8556:Col6a4 UTSW 9 106067053 missense probably damaging 0.96
R8832:Col6a4 UTSW 9 106072154 missense probably benign
R9001:Col6a4 UTSW 9 106067171 missense probably benign 0.26
R9009:Col6a4 UTSW 9 106077205 missense probably benign 0.38
R9069:Col6a4 UTSW 9 106074939 missense possibly damaging 0.85
R9155:Col6a4 UTSW 9 106075010 missense probably benign
R9175:Col6a4 UTSW 9 106080361 missense probably benign
R9176:Col6a4 UTSW 9 106061556 missense probably damaging 1.00
R9295:Col6a4 UTSW 9 106080535 missense probably damaging 1.00
R9298:Col6a4 UTSW 9 106068335 missense probably damaging 0.96
R9389:Col6a4 UTSW 9 106000784 missense probably damaging 1.00
R9424:Col6a4 UTSW 9 106068072 missense probably benign 0.30
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttttactatgtaacaaataacccccc -3'
Posted On 2014-03-14