Mutagenetix > Incidental Mutation

Incidental Mutation 'R1386:Tns3'

160617

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

039448-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R1386 (G1)

Quality Score

224

Status

Not validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8518261 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 321 (Y321F)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000020695
AA Change: Y321F

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: Y321F

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.5%
20x: 87.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,244,255	I235V	probably benign	Het
Acsm4	T	C	7: 119,698,578	I146T	probably benign	Het
Adgrv1	T	C	13: 81,528,865	N1949S	probably benign	Het
Afdn	T	C	17: 13,846,536	V630A	probably damaging	Het
Amfr	A	G	8: 93,985,399	V301A	possibly damaging	Het
Anapc16	T	C	10: 59,996,457	M45V	probably benign	Het
Ankrd12	T	C	17: 65,983,380	E1686G	possibly damaging	Het
Ap2m1	T	G	16: 20,541,229	H193Q	probably damaging	Het
Aplnr	T	C	2: 85,137,461	W277R	possibly damaging	Het
Aspm	A	G	1: 139,457,623	E335G	probably benign	Het
Aspm	C	T	1: 139,478,972	H1866Y	possibly damaging	Het
Atp8b4	T	A	2: 126,378,744	D578V	probably benign	Het
Ccr1	T	A	9: 123,963,962	E177V	probably benign	Het
Cecr2	A	G	6: 120,762,131	E1245G	probably damaging	Het
Cep162	A	T	9: 87,221,202	C638S	probably benign	Het
Ces1b	A	T	8: 93,068,077	I298N	probably benign	Het
Chdh	T	A	14: 30,031,434	L100Q	probably damaging	Het
Chrnd	T	C	1: 87,192,590	I156T	probably damaging	Het
Clpx	G	A	9: 65,326,888	R605Q	probably null	Het
Cnga1	T	A	5: 72,612,183	K135*	probably null	Het
Col6a4	A	T	9: 106,062,945	V1262E	probably benign	Het
Cracr2b	T	C	7: 141,463,568	L53P	probably damaging	Het
Crhr1	T	C	11: 104,174,394	S372P	possibly damaging	Het
Cyp11b2	T	A	15: 74,851,775		probably null	Het
Cyp21a1	T	A	17: 34,802,210	D373V	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ddah1	A	T	3: 145,889,211	Y242F	probably benign	Het
Dlgap3	A	G	4: 127,194,926	D105G	possibly damaging	Het
Dtl	A	G	1: 191,569,717	V76A	probably damaging	Het
Dzank1	A	G	2: 144,491,831	S361P	probably benign	Het
Ehd3	T	A	17: 73,820,543	I157N	probably damaging	Het
Elk4	T	C	1: 132,017,830	F149L	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam83a	A	G	15: 57,986,503	R148G	probably damaging	Het
Farp2	C	A	1: 93,620,151		probably null	Het
Fbxw25	T	A	9: 109,654,641	I168F	possibly damaging	Het
Fermt1	T	C	2: 132,916,058	D479G	probably damaging	Het
Fgf17	C	A	14: 70,636,770	R193L	probably damaging	Het
Foxred2	T	G	15: 77,948,521		probably null	Het
Gad1	T	C	2: 70,574,123	V119A	possibly damaging	Het
Gas2l3	A	G	10: 89,414,353	V301A	possibly damaging	Het
Gimap8	G	A	6: 48,656,653	V469I	probably benign	Het
Gja1	A	T	10: 56,387,969	E141D	probably benign	Het
Glod4	C	T	11: 76,222,003	W268*	probably null	Het
Gm7173	C	T	X: 79,509,901	V323I	possibly damaging	Het
Guf1	C	T	5: 69,563,162	H309Y	probably benign	Het
Hax1	A	G	3: 89,995,849	V215A	probably damaging	Het
Heatr9	T	C	11: 83,518,825	D107G	probably benign	Het
Hephl1	T	A	9: 15,076,754	Y686F	probably benign	Het
Hk3	T	C	13: 55,007,030		probably null	Het
Ikbkb	G	T	8: 22,665,617	Q620K	possibly damaging	Het
Il18rap	C	T	1: 40,531,522	A208V	probably benign	Het
Kif26b	T	C	1: 178,915,644	S1102P	probably benign	Het
Kif5b	A	T	18: 6,226,383	D147E	probably damaging	Het
Klhl3	T	C	13: 58,030,433	T348A	probably damaging	Het
Krt10	T	C	11: 99,385,920		probably benign	Het
Lama3	A	T	18: 12,477,370	H1124L	probably benign	Het
Lin7a	A	T	10: 107,412,122	Q96L	unknown	Het
Ly6c2	T	G	15: 75,110,589	I37L	probably benign	Het
Mov10l1	A	G	15: 89,011,386	Y585C	possibly damaging	Het
Msr1	G	A	8: 39,589,293	Q414*	probably null	Het
Myh13	T	C	11: 67,370,950	C1900R	possibly damaging	Het
Obscn	T	A	11: 59,133,853	N454Y	probably damaging	Het
Olfml2b	T	G	1: 170,681,162	Y530D	probably damaging	Het
Olfr1057	A	G	2: 86,374,921	F164L	probably damaging	Het
Olfr1206	T	A	2: 88,865,353	F249L	probably benign	Het
Olfr1377	T	C	11: 50,985,367	F222S	probably damaging	Het
Olfr1449	A	T	19: 12,935,139	T134S	probably benign	Het
Olfr591	T	A	7: 103,173,367	H90L	probably benign	Het
Olfr868	T	A	9: 20,101,582	N274K	probably benign	Het
Pde10a	T	G	17: 8,953,742	V648G	probably damaging	Het
Pde7b	T	A	10: 20,418,801	H258L	probably damaging	Het
Pik3cb	A	G	9: 99,064,027	V582A	possibly damaging	Het
Plxnb1	T	C	9: 109,101,023	S316P	probably benign	Het
Pmpca	C	T	2: 26,392,518	T246I	probably damaging	Het
Reep3	A	T	10: 67,063,009	V32D	possibly damaging	Het
Rfx4	A	G	10: 84,863,285	M252V	probably damaging	Het
Rnf168	C	A	16: 32,298,963	D447E	probably damaging	Het
Rnf31	T	C	14: 55,596,764	V518A	probably damaging	Het
Rnpc3	A	T	3: 113,613,784	L340*	probably null	Het
Scn2a	A	G	2: 65,688,741	E437G	probably damaging	Het
Scnn1b	C	A	7: 121,902,488	N175K	possibly damaging	Het
Slc39a11	T	A	11: 113,247,724	I344F	probably benign	Het
Slc9a2	T	A	1: 40,719,018	L239Q	probably damaging	Het
Smg5	T	C	3: 88,355,671	F794L	probably damaging	Het
Smim13	C	T	13: 41,272,692	S68L	possibly damaging	Het
Sos2	A	T	12: 69,614,658	Y680N	probably damaging	Het
Spag6	T	A	2: 18,734,246	M329K	possibly damaging	Het
Spire2	G	A	8: 123,361,366		probably null	Het
Tdrd9	T	A	12: 112,044,804	V1149D	probably benign	Het
Top3b	T	C	16: 16,880,629	V112A	probably benign	Het
Trafd1	G	A	5: 121,379,652	T26I	probably damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Vmn2r78	T	C	7: 86,915,407	L20S	unknown	Het
Vmn2r82	A	T	10: 79,378,711	D176V	probably damaging	Het
Vps13b	T	C	15: 35,923,312	F3778L	probably damaging	Het
Vwa3b	T	C	1: 37,051,881		probably null	Het
Vwc2	C	T	11: 11,154,262	P265S	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zfp335	T	C	2: 164,898,241	T764A	probably benign	Het
Zfp366	T	A	13: 99,246,555	V742D	probably damaging	Het
Zfp709	A	T	8: 71,890,662	Y645F	probably damaging	Het
Zmym2	T	A	14: 56,913,091	C424S	probably damaging	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCCTTCAAAACCGGCAGTG -3'
(R):5'- CTGTGACATCTGATCATCTGGCCTC -3'

Sequencing Primer
(F):5'- ACGTGTAGCTCGGGGAC -3'
(R):5'- gcctcaaccttcccaatactg -3'

Posted On

2014-03-14