Incidental Mutation 'R1436:Ust'
ID160650
Institutional Source Beutler Lab
Gene Symbol Ust
Ensembl Gene ENSMUSG00000047712
Gene Nameuronyl-2-sulfotransferase
SynonymsUA2OST, D930010O20Rik
MMRRC Submission 039491-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R1436 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location8204756-8518825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8307438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 167 (T167M)
Ref Sequence ENSEMBL: ENSMUSP00000052017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061601]
Predicted Effect probably damaging
Transcript: ENSMUST00000061601
AA Change: T167M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052017
Gene: ENSMUSG00000047712
AA Change: T167M

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 53 317 8.5e-11 PFAM
Pfam:Sulfotransfer_2 98 359 6.4e-38 PFAM
low complexity region 385 398 N/A INTRINSIC
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,644,213 F292S probably benign Het
Abca13 T C 11: 9,292,646 V1503A probably damaging Het
AI661453 C T 17: 47,466,702 probably benign Het
Ano2 T C 6: 125,867,171 probably null Het
Areg G T 5: 91,139,805 probably benign Het
Atg16l2 A G 7: 101,291,550 V453A probably damaging Het
BC034090 A G 1: 155,225,916 S563P probably benign Het
Bhmt-ps1 A G 4: 26,369,591 noncoding transcript Het
Birc6 C A 17: 74,652,705 P3855Q probably damaging Het
Cd151 A T 7: 141,469,284 K8M probably damaging Het
Cd163 T C 6: 124,327,931 V1089A possibly damaging Het
Chd3 A T 11: 69,357,574 probably null Het
Cnot6l T A 5: 96,134,112 E9V probably damaging Het
Col22a1 A G 15: 71,922,957 probably benign Het
Cyp2c68 A G 19: 39,741,040 M1T probably null Het
Dbp T C 7: 45,708,455 V149A probably damaging Het
Dnah10 T C 5: 124,762,221 V1241A probably benign Het
Galnt10 T C 11: 57,771,469 S314P probably damaging Het
Glce C T 9: 62,070,010 probably null Het
Gm5093 C G 17: 46,439,754 D116H probably damaging Het
Gm8298 A T 3: 59,865,339 D88V probably damaging Het
Golim4 A G 3: 75,878,644 probably null Het
Helz2 A T 2: 181,235,524 I1107N probably damaging Het
Hoxc9 T C 15: 102,981,872 S74P probably benign Het
Ikbkb T A 8: 22,673,403 N297I probably benign Het
Il20ra T A 10: 19,749,252 I93N probably damaging Het
Itch C A 2: 155,192,145 N412K probably damaging Het
Kcna5 T A 6: 126,534,761 T135S probably damaging Het
Lncpint G A 6: 31,181,039 noncoding transcript Het
Lrrc39 A T 3: 116,579,644 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Moxd1 C T 10: 24,244,358 T128M probably damaging Het
Mpeg1 C T 19: 12,462,459 S427F probably damaging Het
Nckap5 T C 1: 126,026,061 Y854C possibly damaging Het
Ncln C T 10: 81,489,893 E373K probably damaging Het
Neurod4 T C 10: 130,270,671 T245A possibly damaging Het
Nsun5 T C 5: 135,370,213 L39P probably damaging Het
Olfr1202 A T 2: 88,817,992 T274S possibly damaging Het
Olfr1303 A G 2: 111,814,561 L55S probably damaging Het
Olfr1368 G T 13: 21,142,992 Q22K probably benign Het
Pde8b T C 13: 95,026,170 T815A probably benign Het
Pofut2 C T 10: 77,268,564 R392W probably damaging Het
Ppip5k2 G A 1: 97,711,782 T1186I probably benign Het
Rhot2 A C 17: 25,841,400 S277R probably benign Het
Satb1 T G 17: 51,804,363 probably null Het
Sec31b T C 19: 44,536,195 I88V probably damaging Het
Selenon T A 4: 134,540,686 E483V probably damaging Het
Serpinc1 A G 1: 160,993,411 T22A possibly damaging Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sf3b1 A G 1: 55,001,421 Y561H possibly damaging Het
Smarcc1 T A 9: 110,118,640 probably benign Het
Stard3nl C T 13: 19,372,649 R107Q probably damaging Het
Syce1 C T 7: 140,777,680 R324H possibly damaging Het
Tnk1 G T 11: 69,852,293 probably benign Het
Trim46 A G 3: 89,243,661 F198L probably damaging Het
Trip4 A T 9: 65,880,951 W71R probably damaging Het
Ubox5 A C 2: 130,597,293 probably benign Het
Zbtb2 T C 10: 4,368,697 Q443R probably benign Het
Zfp407 A G 18: 84,343,071 probably benign Het
Other mutations in Ust
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Ust APN 10 8298078 missense probably benign 0.09
IGL03056:Ust APN 10 8207562 missense probably benign 0.01
R0015:Ust UTSW 10 8330065 splice site probably benign
R0417:Ust UTSW 10 8245936 missense probably damaging 1.00
R0423:Ust UTSW 10 8298148 missense probably damaging 1.00
R0533:Ust UTSW 10 8248080 splice site probably benign
R1344:Ust UTSW 10 8298190 missense possibly damaging 0.82
R1803:Ust UTSW 10 8298055 critical splice donor site probably null
R2059:Ust UTSW 10 8207566 missense probably damaging 1.00
R4248:Ust UTSW 10 8518218 missense possibly damaging 0.67
R4811:Ust UTSW 10 8245941 missense probably damaging 0.97
R5075:Ust UTSW 10 8518224 missense probably damaging 0.97
R5912:Ust UTSW 10 8298061 missense probably benign 0.25
R5950:Ust UTSW 10 8248101 missense probably benign 0.33
R7302:Ust UTSW 10 8518209 missense probably damaging 0.99
R7478:Ust UTSW 10 8390886 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCGCTGTGTTGCTCCTAGATTAC -3'
(R):5'- CTTACAAGAAAGCTCGCCCTTTGC -3'

Sequencing Primer
(F):5'- TTCAGCTAGTATAGTCAAGGAAGC -3'
(R):5'- GCTCGCCCTTTGCAACAAG -3'
Posted On2014-03-14