Incidental Mutation 'R1436:Il20ra'
ID 160651
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission 039491-MU
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1436 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19749252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 93 (I93N)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably damaging
Transcript: ENSMUST00000020185
AA Change: I93N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: I93N

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Meta Mutation Damage Score 0.8646 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency 94% (65/69)
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,644,213 F292S probably benign Het
Abca13 T C 11: 9,292,646 V1503A probably damaging Het
AI661453 C T 17: 47,466,702 probably benign Het
Ano2 T C 6: 125,867,171 probably null Het
Areg G T 5: 91,139,805 probably benign Het
Atg16l2 A G 7: 101,291,550 V453A probably damaging Het
BC034090 A G 1: 155,225,916 S563P probably benign Het
Bhmt-ps1 A G 4: 26,369,591 noncoding transcript Het
Birc6 C A 17: 74,652,705 P3855Q probably damaging Het
Cd151 A T 7: 141,469,284 K8M probably damaging Het
Cd163 T C 6: 124,327,931 V1089A possibly damaging Het
Chd3 A T 11: 69,357,574 probably null Het
Cnot6l T A 5: 96,134,112 E9V probably damaging Het
Col22a1 A G 15: 71,922,957 probably benign Het
Cyp2c68 A G 19: 39,741,040 M1T probably null Het
Dbp T C 7: 45,708,455 V149A probably damaging Het
Dnah10 T C 5: 124,762,221 V1241A probably benign Het
Galnt10 T C 11: 57,771,469 S314P probably damaging Het
Glce C T 9: 62,070,010 probably null Het
Gm5093 C G 17: 46,439,754 D116H probably damaging Het
Gm8298 A T 3: 59,865,339 D88V probably damaging Het
Golim4 A G 3: 75,878,644 probably null Het
Helz2 A T 2: 181,235,524 I1107N probably damaging Het
Hoxc9 T C 15: 102,981,872 S74P probably benign Het
Ikbkb T A 8: 22,673,403 N297I probably benign Het
Itch C A 2: 155,192,145 N412K probably damaging Het
Kcna5 T A 6: 126,534,761 T135S probably damaging Het
Lncpint G A 6: 31,181,039 noncoding transcript Het
Lrrc39 A T 3: 116,579,644 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Moxd1 C T 10: 24,244,358 T128M probably damaging Het
Mpeg1 C T 19: 12,462,459 S427F probably damaging Het
Nckap5 T C 1: 126,026,061 Y854C possibly damaging Het
Ncln C T 10: 81,489,893 E373K probably damaging Het
Neurod4 T C 10: 130,270,671 T245A possibly damaging Het
Nsun5 T C 5: 135,370,213 L39P probably damaging Het
Olfr1202 A T 2: 88,817,992 T274S possibly damaging Het
Olfr1303 A G 2: 111,814,561 L55S probably damaging Het
Olfr1368 G T 13: 21,142,992 Q22K probably benign Het
Pde8b T C 13: 95,026,170 T815A probably benign Het
Pofut2 C T 10: 77,268,564 R392W probably damaging Het
Ppip5k2 G A 1: 97,711,782 T1186I probably benign Het
Rhot2 A C 17: 25,841,400 S277R probably benign Het
Satb1 T G 17: 51,804,363 probably null Het
Sec31b T C 19: 44,536,195 I88V probably damaging Het
Selenon T A 4: 134,540,686 E483V probably damaging Het
Serpinc1 A G 1: 160,993,411 T22A possibly damaging Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sf3b1 A G 1: 55,001,421 Y561H possibly damaging Het
Smarcc1 T A 9: 110,118,640 probably benign Het
Stard3nl C T 13: 19,372,649 R107Q probably damaging Het
Syce1 C T 7: 140,777,680 R324H possibly damaging Het
Tnk1 G T 11: 69,852,293 probably benign Het
Trim46 A G 3: 89,243,661 F198L probably damaging Het
Trip4 A T 9: 65,880,951 W71R probably damaging Het
Ubox5 A C 2: 130,597,293 probably benign Het
Ust G A 10: 8,307,438 T167M probably damaging Het
Zbtb2 T C 10: 4,368,697 Q443R probably benign Het
Zfp407 A G 18: 84,343,071 probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGGATGCACTATCCACACTG -3'
(R):5'- AGCCTAGCAATGCTGGAGAACG -3'

Sequencing Primer
(F):5'- ATAGAAACTCTGACTCATGTTCCCG -3'
(R):5'- TGCTGGAGAACGGTATTACTCAC -3'
Posted On 2014-03-14