Incidental Mutation 'R1436:Moxd1'
ID160652
Institutional Source Beutler Lab
Gene Symbol Moxd1
Ensembl Gene ENSMUSG00000020000
Gene Namemonooxygenase, DBH-like 1
Synonyms3230402N08Rik
MMRRC Submission 039491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1436 (G1)
Quality Score117
Status Validated
Chromosome10
Chromosomal Location24223517-24302790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24244358 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 128 (T128M)
Ref Sequence ENSEMBL: ENSMUSP00000093460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095784]
Predicted Effect probably damaging
Transcript: ENSMUST00000095784
AA Change: T128M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093460
Gene: ENSMUSG00000020000
AA Change: T128M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DoH 59 148 7.89e-15 SMART
Pfam:Cu2_monooxygen 186 315 2.7e-50 PFAM
Pfam:Cu2_monoox_C 334 491 2.1e-48 PFAM
low complexity region 602 613 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,644,213 F292S probably benign Het
Abca13 T C 11: 9,292,646 V1503A probably damaging Het
AI661453 C T 17: 47,466,702 probably benign Het
Ano2 T C 6: 125,867,171 probably null Het
Areg G T 5: 91,139,805 probably benign Het
Atg16l2 A G 7: 101,291,550 V453A probably damaging Het
BC034090 A G 1: 155,225,916 S563P probably benign Het
Bhmt-ps1 A G 4: 26,369,591 noncoding transcript Het
Birc6 C A 17: 74,652,705 P3855Q probably damaging Het
Cd151 A T 7: 141,469,284 K8M probably damaging Het
Cd163 T C 6: 124,327,931 V1089A possibly damaging Het
Chd3 A T 11: 69,357,574 probably null Het
Cnot6l T A 5: 96,134,112 E9V probably damaging Het
Col22a1 A G 15: 71,922,957 probably benign Het
Cyp2c68 A G 19: 39,741,040 M1T probably null Het
Dbp T C 7: 45,708,455 V149A probably damaging Het
Dnah10 T C 5: 124,762,221 V1241A probably benign Het
Galnt10 T C 11: 57,771,469 S314P probably damaging Het
Glce C T 9: 62,070,010 probably null Het
Gm5093 C G 17: 46,439,754 D116H probably damaging Het
Gm8298 A T 3: 59,865,339 D88V probably damaging Het
Golim4 A G 3: 75,878,644 probably null Het
Helz2 A T 2: 181,235,524 I1107N probably damaging Het
Hoxc9 T C 15: 102,981,872 S74P probably benign Het
Ikbkb T A 8: 22,673,403 N297I probably benign Het
Il20ra T A 10: 19,749,252 I93N probably damaging Het
Itch C A 2: 155,192,145 N412K probably damaging Het
Kcna5 T A 6: 126,534,761 T135S probably damaging Het
Lncpint G A 6: 31,181,039 noncoding transcript Het
Lrrc39 A T 3: 116,579,644 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Mpeg1 C T 19: 12,462,459 S427F probably damaging Het
Nckap5 T C 1: 126,026,061 Y854C possibly damaging Het
Ncln C T 10: 81,489,893 E373K probably damaging Het
Neurod4 T C 10: 130,270,671 T245A possibly damaging Het
Nsun5 T C 5: 135,370,213 L39P probably damaging Het
Olfr1202 A T 2: 88,817,992 T274S possibly damaging Het
Olfr1303 A G 2: 111,814,561 L55S probably damaging Het
Olfr1368 G T 13: 21,142,992 Q22K probably benign Het
Pde8b T C 13: 95,026,170 T815A probably benign Het
Pofut2 C T 10: 77,268,564 R392W probably damaging Het
Ppip5k2 G A 1: 97,711,782 T1186I probably benign Het
Rhot2 A C 17: 25,841,400 S277R probably benign Het
Satb1 T G 17: 51,804,363 probably null Het
Sec31b T C 19: 44,536,195 I88V probably damaging Het
Selenon T A 4: 134,540,686 E483V probably damaging Het
Serpinc1 A G 1: 160,993,411 T22A possibly damaging Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sf3b1 A G 1: 55,001,421 Y561H possibly damaging Het
Smarcc1 T A 9: 110,118,640 probably benign Het
Stard3nl C T 13: 19,372,649 R107Q probably damaging Het
Syce1 C T 7: 140,777,680 R324H possibly damaging Het
Tnk1 G T 11: 69,852,293 probably benign Het
Trim46 A G 3: 89,243,661 F198L probably damaging Het
Trip4 A T 9: 65,880,951 W71R probably damaging Het
Ubox5 A C 2: 130,597,293 probably benign Het
Ust G A 10: 8,307,438 T167M probably damaging Het
Zbtb2 T C 10: 4,368,697 Q443R probably benign Het
Zfp407 A G 18: 84,343,071 probably benign Het
Other mutations in Moxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL00227:Moxd1 APN 10 24282593 missense probably damaging 1.00
IGL00331:Moxd1 APN 10 24282555 splice site probably benign
IGL01074:Moxd1 APN 10 24279384 missense probably benign 0.45
IGL01462:Moxd1 APN 10 24244388 critical splice donor site probably null
IGL01777:Moxd1 APN 10 24252596 missense probably benign 0.00
IGL02051:Moxd1 APN 10 24253018 splice site probably null
IGL02272:Moxd1 APN 10 24282700 nonsense probably null
IGL02343:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL02425:Moxd1 APN 10 24279436 missense probably benign 0.01
IGL02448:Moxd1 APN 10 24282719 missense probably damaging 0.99
IGL02452:Moxd1 APN 10 24282752 missense probably damaging 1.00
IGL03301:Moxd1 APN 10 24279484 missense probably damaging 0.99
R0631:Moxd1 UTSW 10 24252954 missense probably damaging 1.00
R1484:Moxd1 UTSW 10 24223860 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1713:Moxd1 UTSW 10 24281496 missense probably damaging 1.00
R1954:Moxd1 UTSW 10 24279883 missense probably benign 0.17
R3115:Moxd1 UTSW 10 24301531 nonsense probably null
R3116:Moxd1 UTSW 10 24301531 nonsense probably null
R5183:Moxd1 UTSW 10 24279547 critical splice donor site probably null
R5183:Moxd1 UTSW 10 24287136 missense probably damaging 1.00
R5322:Moxd1 UTSW 10 24244253 missense possibly damaging 0.88
R5728:Moxd1 UTSW 10 24223683 missense possibly damaging 0.92
R5824:Moxd1 UTSW 10 24287097 missense probably damaging 1.00
R6158:Moxd1 UTSW 10 24284777 missense probably damaging 1.00
R6322:Moxd1 UTSW 10 24284811 missense probably damaging 1.00
R6662:Moxd1 UTSW 10 24284760 missense probably damaging 1.00
R6827:Moxd1 UTSW 10 24279850 missense probably benign 0.29
R6928:Moxd1 UTSW 10 24300288 missense probably damaging 1.00
R7048:Moxd1 UTSW 10 24281476 missense probably damaging 1.00
R7320:Moxd1 UTSW 10 24301465 missense probably benign 0.05
R7736:Moxd1 UTSW 10 24282710 missense probably damaging 1.00
X0063:Moxd1 UTSW 10 24252500 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCTTGTCCACAAAAGGCCAGTTC -3'
(R):5'- GATGCCTGAGAAGTGTGTGACTCTG -3'

Sequencing Primer
(F):5'- TTAGGAAGTCCCAGGATTCATAAAG -3'
(R):5'- AAGTGTGTGACTCTGGTGATCC -3'
Posted On2014-03-14