Incidental Mutation 'R1447:Atp8b2'
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
MMRRC Submission 039502-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R1447 (G1)
Quality Score225
Status Not validated
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89944170 bp
Amino Acid Change Isoleucine to Asparagine at position 906 (I906N)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]
Predicted Effect probably damaging
Transcript: ENSMUST00000069805
AA Change: I925N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: I925N

low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107396
AA Change: I930N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: I930N

Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect probably benign
Transcript: ENSMUST00000166502
SMART Domains Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

SCOP:d1eula_ 2 95 5e-7 SMART
low complexity region 100 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably damaging
Transcript: ENSMUST00000168276
AA Change: I906N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: I906N

low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect probably benign
Transcript: ENSMUST00000171941
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671

Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Ccdc162 T C 10: 41,580,247 E360G probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Eef1akmt1 T A 14: 57,565,984 K38* probably null Het
Enpp2 C T 15: 54,919,598 probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Usp47 G T 7: 112,074,568 probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfhx3 A C 8: 108,948,444 Q2042P probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 splice site probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89945524 missense
R7552:Atp8b2 UTSW 3 89946764 missense probably damaging 1.00
R8061:Atp8b2 UTSW 3 89946220 unclassified probably benign
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggttgagacagagcattgaaag -3'
Posted On2014-03-14