Incidental Mutation 'R1447:Zfhx3'
ID160708
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Namezinc finger homeobox 3
SynonymsA230102L03Rik, Atbf1, WBP9
MMRRC Submission 039502-MU
Accession Numbers

Genbank: NM_007496

Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R1447 (G1)
Quality Score125
Status Not validated
Chromosome8
Chromosomal Location107942644-108961630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108948444 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 2042 (Q2042P)
Ref Sequence ENSEMBL: ENSMUSP00000152353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000220518]
Predicted Effect probably benign
Transcript: ENSMUST00000043896
AA Change: Q2042P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: Q2042P

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220518
AA Change: Q2042P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
Atp8b2 A T 3: 89,944,170 I906N probably damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Ccdc162 T C 10: 41,580,247 E360G probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Eef1akmt1 T A 14: 57,565,984 K38* probably null Het
Enpp2 C T 15: 54,919,598 probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Usp47 G T 7: 112,074,568 probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 108793594 missense probably benign 0.00
IGL01946:Zfhx3 APN 8 108933929 missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 108947193 missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 108947234 missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 108793883 missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 108955742 missense unknown
IGL02406:Zfhx3 APN 8 108955742 missense unknown
IGL02408:Zfhx3 APN 8 108955372 splice site probably benign
IGL02549:Zfhx3 APN 8 108800509 missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 108856830 missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 108793535 missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 108793188 missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 108794727 missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 108946550 missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 108956094 small insertion probably benign
FR4589:Zfhx3 UTSW 8 108956101 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956088 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956102 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956103 small insertion probably benign
G5030:Zfhx3 UTSW 8 108951459 missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 108950178 missense probably benign 0.02
R0090:Zfhx3 UTSW 8 108950057 missense possibly damaging 0.85
R0330:Zfhx3 UTSW 8 108948957 missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 108946623 missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 108951246 missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 108800509 missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 108794187 missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 108948539 missense probably benign 0.03
R0614:Zfhx3 UTSW 8 108948967 nonsense probably null
R0653:Zfhx3 UTSW 8 108946808 missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 108955650 missense unknown
R0825:Zfhx3 UTSW 8 108949208 missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 108794411 missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 108933833 missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 108800698 splice site probably benign
R1412:Zfhx3 UTSW 8 108914567 missense possibly damaging 0.88
R1530:Zfhx3 UTSW 8 108948489 missense probably damaging 1.00
R1745:Zfhx3 UTSW 8 108955862 missense unknown
R1764:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R1781:Zfhx3 UTSW 8 108793535 missense probably benign 0.01
R1917:Zfhx3 UTSW 8 108956248 missense unknown
R1956:Zfhx3 UTSW 8 108794142 missense probably benign 0.02
R2049:Zfhx3 UTSW 8 108945177 missense probably benign 0.01
R2196:Zfhx3 UTSW 8 108800253 missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 108956032 missense unknown
R3765:Zfhx3 UTSW 8 108792762 missense probably damaging 0.97
R4162:Zfhx3 UTSW 8 108956987 missense unknown
R4243:Zfhx3 UTSW 8 108792320 missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 108956390 missense unknown
R4433:Zfhx3 UTSW 8 108955637 missense unknown
R4509:Zfhx3 UTSW 8 108793779 missense probably benign 0.01
R4731:Zfhx3 UTSW 8 108956084 missense unknown
R4788:Zfhx3 UTSW 8 108794210 missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 108947961 missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 108957007 missense unknown
R4907:Zfhx3 UTSW 8 108793354 missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 108947850 missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 108948317 missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 108800575 missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 108951185 missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 108946814 missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 108792399 missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 108956210 missense unknown
R5541:Zfhx3 UTSW 8 108948951 missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 108955991 missense unknown
R5700:Zfhx3 UTSW 8 108933867 missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 108800332 missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 108793446 missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 108946698 missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 108950851 missense possibly damaging 0.91
R6020:Zfhx3 UTSW 8 108792527 missense probably damaging 1.00
R6028:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 108947421 missense probably benign 0.04
R6253:Zfhx3 UTSW 8 108955388 missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 108946619 missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 108949517 missense probably benign 0.20
R6829:Zfhx3 UTSW 8 108950283 missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 108800528 missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 108951392 missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 108956821 missense unknown
R6927:Zfhx3 UTSW 8 108956821 missense unknown
R7152:Zfhx3 UTSW 8 108948207 missense possibly damaging 0.94
R7169:Zfhx3 UTSW 8 108951398 missense possibly damaging 0.86
R7214:Zfhx3 UTSW 8 108948861 missense probably damaging 0.98
R7378:Zfhx3 UTSW 8 108793248 missense probably damaging 0.99
R7391:Zfhx3 UTSW 8 108947843 missense probably damaging 0.96
R7442:Zfhx3 UTSW 8 108792836 missense probably damaging 0.97
R7636:Zfhx3 UTSW 8 108946809 missense probably benign 0.25
R7649:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R7699:Zfhx3 UTSW 8 108951122 missense probably benign 0.18
R7728:Zfhx3 UTSW 8 108951569 missense probably benign 0.01
R7780:Zfhx3 UTSW 8 108951651 missense possibly damaging 0.53
R7904:Zfhx3 UTSW 8 108951063 missense probably damaging 0.98
R8032:Zfhx3 UTSW 8 108951222 missense possibly damaging 0.51
R8158:Zfhx3 UTSW 8 108948721 missense possibly damaging 0.82
R8163:Zfhx3 UTSW 8 108949293 missense probably damaging 1.00
R8215:Zfhx3 UTSW 8 108950717 missense probably benign
R8217:Zfhx3 UTSW 8 108950717 missense probably benign
R8218:Zfhx3 UTSW 8 108950717 missense probably benign
R8369:Zfhx3 UTSW 8 108856816 missense possibly damaging 0.82
RF027:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF028:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF029:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF031:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF032:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF037:Zfhx3 UTSW 8 108956098 nonsense probably null
RF038:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF040:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956088 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF054:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF060:Zfhx3 UTSW 8 108956088 small insertion probably benign
X0019:Zfhx3 UTSW 8 108951653 missense probably benign 0.00
X0026:Zfhx3 UTSW 8 108949145 missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 108951357 missense possibly damaging 0.72
Z1176:Zfhx3 UTSW 8 108793923 missense probably benign 0.09
Z1176:Zfhx3 UTSW 8 108800449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCACTGCCAGATGCCTCGAAG -3'
(R):5'- GTCTGCATCATCAGTGGCGAGAAG -3'

Sequencing Primer
(F):5'- GCATTGCTTCAGATGCCAG -3'
(R):5'- AGATGGGCAGCTCCATTG -3'
Posted On2014-03-14