Incidental Mutation 'R1447:Ccdc162'
ID160714
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
MMRRC Submission 039502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1447 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41580247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 360 (E360G)
Ref Sequence ENSEMBL: ENSMUSP00000151415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095227
SMART Domains Protein: ENSMUSP00000092852
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 140 179 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099932
AA Change: E170G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: E170G

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170047
Predicted Effect probably damaging
Transcript: ENSMUST00000179614
AA Change: E360G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: E360G

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189488
AA Change: E1633G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: E1633G

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219054
AA Change: E360G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
Atp8b2 A T 3: 89,944,170 I906N probably damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Eef1akmt1 T A 14: 57,565,984 K38* probably null Het
Enpp2 C T 15: 54,919,598 probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Usp47 G T 7: 112,074,568 probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfhx3 A C 8: 108,948,444 Q2042P probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41587375 missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41690113 missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41634119 missense probably benign 0.03
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGAGCGAATATTACTCAGCACACC -3'
(R):5'- GAAGAGTTGCCAACAACTTGAAGCAC -3'

Sequencing Primer
(F):5'- CTGGGAAAAGCCTCTTCAAAATG -3'
(R):5'- GTCTATAAAGGGTTTGGATGACAG -3'
Posted On2014-03-14