Incidental Mutation 'R1447:Eef1akmt1'
Institutional Source Beutler Lab
Gene Symbol Eef1akmt1
Ensembl Gene ENSMUSG00000021951
Gene NameEEF1A alpha lysine methyltransferase 1
SynonymsAyu21-96, N6amt2, Gt(Ayu21)96Imeg, GtAyu21-96, 2510005D08Rik
MMRRC Submission 039502-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1447 (G1)
Quality Score225
Status Not validated
Chromosomal Location57549597-57571612 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57565984 bp
Amino Acid Change Lysine to Stop codon at position 38 (K38*)
Ref Sequence ENSEMBL: ENSMUSP00000022518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022518]
Predicted Effect probably null
Transcript: ENSMUST00000022518
AA Change: K38*
SMART Domains Protein: ENSMUSP00000022518
Gene: ENSMUSG00000021951
AA Change: K38*

Pfam:N6-adenineMlase 59 218 7.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225504
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
Atp8b2 A T 3: 89,944,170 I906N probably damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Ccdc162 T C 10: 41,580,247 E360G probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Enpp2 C T 15: 54,919,598 probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Usp47 G T 7: 112,074,568 probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfhx3 A C 8: 108,948,444 Q2042P probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Eef1akmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Eef1akmt1 APN 14 57549790 missense probably damaging 1.00
IGL02011:Eef1akmt1 APN 14 57558098 missense probably damaging 1.00
IGL02839:Eef1akmt1 APN 14 57549781 missense probably damaging 1.00
IGL03090:Eef1akmt1 APN 14 57558086 missense probably damaging 1.00
R1383:Eef1akmt1 UTSW 14 57558032 critical splice donor site probably null
R1994:Eef1akmt1 UTSW 14 57550454 missense probably benign 0.02
R3026:Eef1akmt1 UTSW 14 57550434 missense probably damaging 1.00
R4582:Eef1akmt1 UTSW 14 57550448 missense probably damaging 1.00
R4921:Eef1akmt1 UTSW 14 57550632 missense probably damaging 0.97
R5071:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R5073:Eef1akmt1 UTSW 14 57566007 missense probably damaging 1.00
R6112:Eef1akmt1 UTSW 14 57549873 missense possibly damaging 0.91
R7578:Eef1akmt1 UTSW 14 57549871 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- catagcaagttccagaacacc -3'
Posted On2014-03-14