Mutagenetix > Incidental Mutation

Incidental Mutation 'R1447:Adamts12'

160730

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

039502-MU

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R1447 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11263361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 603 (D603V)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061318
AA Change: D603V

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D603V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 93.8%
20x: 84.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,965,586	L2048P	probably damaging	Het
Ahnak	A	T	19: 9,007,082	E1910V	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Amotl1	A	G	9: 14,555,742	V704A	probably benign	Het
Ankrd50	A	T	3: 38,455,542	V892E	probably damaging	Het
Aoc1	G	A	6: 48,906,242	V351I	probably benign	Het
Atp6v1b1	T	C	6: 83,757,942	V412A	possibly damaging	Het
Atp8b2	A	T	3: 89,944,170	I906N	probably damaging	Het
BC005561	T	C	5: 104,522,204	S1531P	possibly damaging	Het
Bnc2	A	G	4: 84,293,220	V304A	probably benign	Het
Btaf1	A	G	19: 36,992,454	D1176G	probably benign	Het
C1qtnf3	G	A	15: 10,952,649	G66R	probably damaging	Het
Ccdc162	T	C	10: 41,580,247	E360G	probably damaging	Het
Csmd1	C	A	8: 15,925,306	G2968*	probably null	Het
Cyp2j7	A	T	4: 96,195,293	F473L	possibly damaging	Het
Ddx24	T	C	12: 103,424,307	K142E	possibly damaging	Het
Dnah1	A	T	14: 31,306,898	M625K	probably benign	Het
Dnah9	A	T	11: 66,108,482	Y944N	possibly damaging	Het
Eef1akmt1	T	A	14: 57,565,984	K38*	probably null	Het
Enpp2	C	T	15: 54,919,598		probably null	Het
Eps8l1	A	G	7: 4,474,056	E508G	probably damaging	Het
Etaa1	A	T	11: 17,946,625	D497E	possibly damaging	Het
Fam181b	C	T	7: 93,080,160	A47V	probably damaging	Het
Fubp3	T	C	2: 31,600,547	V221A	probably damaging	Het
Golga2	T	C	2: 32,297,776	V191A	possibly damaging	Het
Haus5	G	T	7: 30,661,791		probably null	Het
Hydin	T	C	8: 110,523,166	L2247P	probably damaging	Het
Lama5	A	C	2: 180,185,878	I2197S	probably damaging	Het
Mapre3	C	T	5: 30,861,807		probably benign	Het
Mast2	C	A	4: 116,312,013	M733I	probably benign	Het
Mphosph10	A	T	7: 64,380,950	F514I	probably damaging	Het
Mterf3	A	G	13: 66,917,039	L266P	probably damaging	Het
Nup205	A	G	6: 35,215,185	D1114G	probably benign	Het
Olfr356	T	G	2: 36,937,776	V219G	possibly damaging	Het
Olfr380	A	G	11: 73,453,874	F113L	probably benign	Het
Phf24	G	T	4: 42,938,232	E119*	probably null	Het
Pik3r5	G	A	11: 68,494,177	R636Q	probably benign	Het
Pla2g16	G	A	19: 7,579,233	R133H	probably benign	Het
Rida	T	A	15: 34,488,611	Q45L	possibly damaging	Het
Ros1	T	C	10: 52,098,858	T1544A	possibly damaging	Het
Rpl7	T	A	1: 16,102,597	Y166F	probably benign	Het
Rps6ka5	A	G	12: 100,577,825	I338T	probably benign	Het
Scn3a	A	T	2: 65,469,980	N1347K	probably damaging	Het
Serpinb6d	A	G	13: 33,670,756	D238G	probably benign	Het
Sh3rf2	T	A	18: 42,101,671	I173N	probably benign	Het
Smarcc2	T	C	10: 128,469,791		probably null	Het
Thsd4	T	C	9: 59,997,213	N567D	probably benign	Het
Tmprss13	C	A	9: 45,328,580	P62Q	unknown	Het
Tmprss7	T	C	16: 45,680,670	Q256R	probably benign	Het
Tssc4	A	G	7: 143,070,155	T67A	probably benign	Het
Tssk5	G	A	15: 76,372,104	Q372*	probably null	Het
Usp47	G	T	7: 112,074,568		probably null	Het
Utp15	A	G	13: 98,252,878	I304T	possibly damaging	Het
Vmn1r35	A	C	6: 66,678,906	V93G	probably benign	Het
Zfhx3	A	C	8: 108,948,444	Q2042P	probably benign	Het
Zfp532	C	A	18: 65,624,990	R665S	probably damaging	Het
Zfp976	G	T	7: 42,612,599	P605T	possibly damaging	Het
Zfpl1	A	G	19: 6,082,619	V125A	possibly damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCTTAGGACTGAAAGGCTGATGAGAAAC -3'
(R):5'- TCTACAACTGAGAAACCCTGGTAGCATA -3'

Sequencing Primer
(F):5'- GTTTCTTTAGGTCAGAAACAGGC -3'
(R):5'- GAAACCCTGGTAGCATAGCTCTC -3'

Posted On

2014-03-14