Incidental Mutation 'R1447:Enpp2'
ID160732
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission 039502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1447 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 54919598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516] [ENSMUST00000226339] [ENSMUST00000228222]
Predicted Effect probably null
Transcript: ENSMUST00000041591
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167541
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171545
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173516
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227483
Predicted Effect probably null
Transcript: ENSMUST00000228222
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 84.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,965,586 L2048P probably damaging Het
Adamts12 A T 15: 11,263,361 D603V probably benign Het
Ahnak A T 19: 9,007,082 E1910V probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amotl1 A G 9: 14,555,742 V704A probably benign Het
Ankrd50 A T 3: 38,455,542 V892E probably damaging Het
Aoc1 G A 6: 48,906,242 V351I probably benign Het
Atp6v1b1 T C 6: 83,757,942 V412A possibly damaging Het
Atp8b2 A T 3: 89,944,170 I906N probably damaging Het
BC005561 T C 5: 104,522,204 S1531P possibly damaging Het
Bnc2 A G 4: 84,293,220 V304A probably benign Het
Btaf1 A G 19: 36,992,454 D1176G probably benign Het
C1qtnf3 G A 15: 10,952,649 G66R probably damaging Het
Ccdc162 T C 10: 41,580,247 E360G probably damaging Het
Csmd1 C A 8: 15,925,306 G2968* probably null Het
Cyp2j7 A T 4: 96,195,293 F473L possibly damaging Het
Ddx24 T C 12: 103,424,307 K142E possibly damaging Het
Dnah1 A T 14: 31,306,898 M625K probably benign Het
Dnah9 A T 11: 66,108,482 Y944N possibly damaging Het
Eef1akmt1 T A 14: 57,565,984 K38* probably null Het
Eps8l1 A G 7: 4,474,056 E508G probably damaging Het
Etaa1 A T 11: 17,946,625 D497E possibly damaging Het
Fam181b C T 7: 93,080,160 A47V probably damaging Het
Fubp3 T C 2: 31,600,547 V221A probably damaging Het
Golga2 T C 2: 32,297,776 V191A possibly damaging Het
Haus5 G T 7: 30,661,791 probably null Het
Hydin T C 8: 110,523,166 L2247P probably damaging Het
Lama5 A C 2: 180,185,878 I2197S probably damaging Het
Mapre3 C T 5: 30,861,807 probably benign Het
Mast2 C A 4: 116,312,013 M733I probably benign Het
Mphosph10 A T 7: 64,380,950 F514I probably damaging Het
Mterf3 A G 13: 66,917,039 L266P probably damaging Het
Nup205 A G 6: 35,215,185 D1114G probably benign Het
Olfr356 T G 2: 36,937,776 V219G possibly damaging Het
Olfr380 A G 11: 73,453,874 F113L probably benign Het
Phf24 G T 4: 42,938,232 E119* probably null Het
Pik3r5 G A 11: 68,494,177 R636Q probably benign Het
Pla2g16 G A 19: 7,579,233 R133H probably benign Het
Rida T A 15: 34,488,611 Q45L possibly damaging Het
Ros1 T C 10: 52,098,858 T1544A possibly damaging Het
Rpl7 T A 1: 16,102,597 Y166F probably benign Het
Rps6ka5 A G 12: 100,577,825 I338T probably benign Het
Scn3a A T 2: 65,469,980 N1347K probably damaging Het
Serpinb6d A G 13: 33,670,756 D238G probably benign Het
Sh3rf2 T A 18: 42,101,671 I173N probably benign Het
Smarcc2 T C 10: 128,469,791 probably null Het
Thsd4 T C 9: 59,997,213 N567D probably benign Het
Tmprss13 C A 9: 45,328,580 P62Q unknown Het
Tmprss7 T C 16: 45,680,670 Q256R probably benign Het
Tssc4 A G 7: 143,070,155 T67A probably benign Het
Tssk5 G A 15: 76,372,104 Q372* probably null Het
Usp47 G T 7: 112,074,568 probably null Het
Utp15 A G 13: 98,252,878 I304T possibly damaging Het
Vmn1r35 A C 6: 66,678,906 V93G probably benign Het
Zfhx3 A C 8: 108,948,444 Q2042P probably benign Het
Zfp532 C A 18: 65,624,990 R665S probably damaging Het
Zfp976 G T 7: 42,612,599 P605T possibly damaging Het
Zfpl1 A G 19: 6,082,619 V125A possibly damaging Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 intron probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
R7494:Enpp2 UTSW 15 54910158 missense probably damaging 1.00
R7557:Enpp2 UTSW 15 54910140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGCTCCGAAAACTCACCTTG -3'
(R):5'- TGCTTCCATGCACTTTGAATGCATC -3'

Sequencing Primer
(F):5'- TGAGGGTTCCCCTAGTCTCAG -3'
(R):5'- CCATGCACTTTGAATGCATCTAATC -3'
Posted On2014-03-14