Incidental Mutation 'R1438:Ptpn1'
ID160750
Institutional Source Beutler Lab
Gene Symbol Ptpn1
Ensembl Gene ENSMUSG00000027540
Gene Nameprotein tyrosine phosphatase, non-receptor type 1
SynonymsPTP-1B, PTP1B
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167932057-167979385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167976609 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 424 (Y424H)
Ref Sequence ENSEMBL: ENSMUSP00000029053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053] [ENSMUST00000099073]
Predicted Effect probably damaging
Transcript: ENSMUST00000029053
AA Change: Y424H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: Y424H

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099073
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577

DomainStartEndE-ValueType
Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147210
Meta Mutation Damage Score 0.4790 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Ptpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Ptpn1 APN 2 167967792 missense probably damaging 1.00
IGL02976:Ptpn1 APN 2 167971784 missense probably benign 0.01
R0106:Ptpn1 UTSW 2 167976418 unclassified probably benign
R0106:Ptpn1 UTSW 2 167976418 unclassified probably benign
R3010:Ptpn1 UTSW 2 167974822 missense probably damaging 1.00
R3607:Ptpn1 UTSW 2 167975507 missense probably benign
R3755:Ptpn1 UTSW 2 167974223 missense probably damaging 1.00
R4075:Ptpn1 UTSW 2 167976513 unclassified probably null
R4160:Ptpn1 UTSW 2 167967811 missense probably benign 0.04
R4627:Ptpn1 UTSW 2 167967781 missense probably benign 0.00
R4754:Ptpn1 UTSW 2 167974160 missense probably damaging 1.00
R5596:Ptpn1 UTSW 2 167974763 missense probably damaging 1.00
R5920:Ptpn1 UTSW 2 167971748 missense probably benign 0.02
R6133:Ptpn1 UTSW 2 167967796 missense possibly damaging 0.94
R7296:Ptpn1 UTSW 2 167974772 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAGCATGAGTCCAGACACTGAAG -3'
(R):5'- AGAAGCTCACCAGTGCCTAGCATC -3'

Sequencing Primer
(F):5'- CATGAGTCCAGACACTGAAGTTAGG -3'
(R):5'- TCTCCTGAACAGGTTAAGGC -3'
Posted On2014-03-14