Incidental Mutation 'R1438:Sgf29'
ID160772
Institutional Source Beutler Lab
Gene Symbol Sgf29
Ensembl Gene ENSMUSG00000030714
Gene NameSAGA complex associated factor 29
Synonyms1700023O11Rik, Ccdc101
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126649309-126672925 bp(+) (GRCm38)
Type of Mutationunclassified (2377 bp from exon)
DNA Base Change (assembly) G to A at 126671891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000106371] [ENSMUST00000106372] [ENSMUST00000106373] [ENSMUST00000155419] [ENSMUST00000205507] [ENSMUST00000206359]
Predicted Effect probably benign
Transcript: ENSMUST00000032956
SMART Domains Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714

DomainStartEndE-ValueType
coiled coil region 66 86 N/A INTRINSIC
Pfam:DUF1325 158 288 5.2e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106371
SMART Domains Protein: ENSMUSP00000101979
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 256 1.1e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106372
SMART Domains Protein: ENSMUSP00000101980
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 41 263 1.1e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106373
SMART Domains Protein: ENSMUSP00000101981
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 284 1.1e-89 PFAM
Pfam:Sulfotransfer_3 36 210 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123382
Predicted Effect probably benign
Transcript: ENSMUST00000129786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152231
Predicted Effect probably null
Transcript: ENSMUST00000155419
SMART Domains Protein: ENSMUSP00000121514
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 121 6e-23 PFAM
Pfam:Sulfotransfer_1 133 181 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205507
Predicted Effect probably benign
Transcript: ENSMUST00000206359
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Sgf29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Sgf29 APN 7 126664931 missense possibly damaging 0.94
IGL02546:Sgf29 APN 7 126671853 missense probably damaging 1.00
xiangfan UTSW 7 126663938 missense possibly damaging 0.90
R0280:Sgf29 UTSW 7 126671571 missense probably benign 0.45
R1987:Sgf29 UTSW 7 126649477 splice site probably null
R4342:Sgf29 UTSW 7 126671777 missense probably damaging 1.00
R4489:Sgf29 UTSW 7 126663938 missense possibly damaging 0.90
R4869:Sgf29 UTSW 7 126649375 unclassified probably benign
R4928:Sgf29 UTSW 7 126664982 missense probably damaging 1.00
R7122:Sgf29 UTSW 7 126672049 missense probably null 0.44
R7319:Sgf29 UTSW 7 126671649 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACAGGCTTTCTCTACAGGCCCC -3'
(R):5'- AGAAACTTGGTGACTCCCCTGCTC -3'

Sequencing Primer
(F):5'- TCTACAGGCCCCCACCC -3'
(R):5'- ACCTGGACACTCACTCTTTG -3'
Posted On2014-03-14