Incidental Mutation 'R1438:Prtg'
ID160778
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 72910750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably benign
Transcript: ENSMUST00000055535
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184274
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1121:Prtg UTSW 9 72906167 missense probably benign 0.15
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5563:Prtg UTSW 9 72856898 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5738:Prtg UTSW 9 72912006 missense probably benign 0.16
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5961:Prtg UTSW 9 72856946 missense probably benign
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7324:Prtg UTSW 9 72890840 missense probably damaging 0.96
R7372:Prtg UTSW 9 72851566 nonsense probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCCCATGTAGGAGAGGTCACCAT -3'
(R):5'- ACCACATCTCAGATTACTGTCCGAACT -3'

Sequencing Primer
(F):5'- ATATGTGACCATTGTCTCCTTTGG -3'
(R):5'- AGATTACTGTCCGAACTTTCTTTC -3'
Posted On2014-03-14