Incidental Mutation 'R1438:Eftud2'
ID160795
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Nameelongation factor Tu GTP binding domain containing 2
Synonyms116kDa, Snrp116, U5-116kD
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1438 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102838473-102880985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102860042 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 308 (F308L)
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000138483] [ENSMUST00000173679]
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: F318L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: F318L

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: F317L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: F317L

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131678
Predicted Effect probably benign
Transcript: ENSMUST00000138483
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: F308L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: F308L

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.9586 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Exoc3 A T 13: 74,190,179 M362K probably damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 intron probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GACAATAAGAGGTGATGAGTGCCCC -3'
(R):5'- CTGAGGCTGGAGCATTAAGACTGAC -3'

Sequencing Primer
(F):5'- TTCTGAGCCATTCAGCAGGA -3'
(R):5'- ACAGGGAGTTGCTTGCC -3'
Posted On2014-03-14