Incidental Mutation 'R1438:Exoc3'
ID160803
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Nameexocyst complex component 3
SynonymsSec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission 039493-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1438 (G1)
Quality Score159
Status Validated
Chromosome13
Chromosomal Location74169488-74208732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74190179 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 362 (M362K)
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000222213]
Predicted Effect probably damaging
Transcript: ENSMUST00000035934
AA Change: M362K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: M362K

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222213
Meta Mutation Damage Score 0.8885 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A T 5: 137,554,609 I67F probably damaging Het
Adam24 A T 8: 40,681,392 N633I probably benign Het
Adgrg6 T C 10: 14,468,841 S123G possibly damaging Het
Afdn T A 17: 13,855,390 F940L probably damaging Het
Ahrr A T 13: 74,224,868 Y26* probably null Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Aox3 A T 1: 58,153,178 T536S probably benign Het
AU019823 C A 9: 50,607,672 K213N possibly damaging Het
Boc A T 16: 44,488,746 probably null Het
Cchcr1 T C 17: 35,530,560 probably null Het
Cct2 A T 10: 117,054,992 probably benign Het
Cd84 A T 1: 171,852,118 Y121F probably damaging Het
Cecr2 T A 6: 120,761,472 C275* probably null Het
Chchd3 C A 6: 33,008,568 probably benign Het
Ckmt2 A T 13: 91,859,852 probably benign Het
Col5a3 T C 9: 20,779,957 K1131E probably damaging Het
Dek A T 13: 47,088,171 S306T probably benign Het
Dhx32 T C 7: 133,737,340 E322G possibly damaging Het
Dlg5 T A 14: 24,154,605 D941V possibly damaging Het
Dnah10 A G 5: 124,798,945 N2559S probably benign Het
Dnajc3 A G 14: 118,968,106 T171A probably benign Het
Eftud2 G T 11: 102,860,042 F308L probably damaging Het
Elp6 T C 9: 110,314,055 F95S probably damaging Het
Emsy C T 7: 98,621,406 V450I possibly damaging Het
Fat2 A T 11: 55,287,811 D1474E probably damaging Het
Fcgbp T A 7: 28,103,733 C1587* probably null Het
Fosl2 T A 5: 32,146,985 L88Q probably damaging Het
Fsd2 T C 7: 81,548,873 D381G probably benign Het
Golim4 A C 3: 75,956,133 S56A probably damaging Het
Gpr39 T C 1: 125,872,356 probably benign Het
Gucy1b2 T C 14: 62,414,321 I409V probably damaging Het
Hivep1 A G 13: 42,158,120 T1279A probably benign Het
Ifit1bl2 T A 19: 34,619,169 Q349L possibly damaging Het
Kcnc1 A T 7: 46,428,267 I498F possibly damaging Het
Kctd21 T A 7: 97,347,497 I59N probably damaging Het
Lama5 T A 2: 180,182,800 T2577S probably benign Het
Mief2 G T 11: 60,730,314 R9M possibly damaging Het
Mmp3 T C 9: 7,453,705 V442A probably benign Het
Nrxn3 C T 12: 90,332,135 R477W probably damaging Het
Olfr1126 A G 2: 87,457,992 T276A probably benign Het
Olfr57 T A 10: 79,035,288 V164E possibly damaging Het
Parp1 A G 1: 180,591,242 T656A probably benign Het
Pcdhb19 A G 18: 37,497,962 D270G probably damaging Het
Phlpp1 A G 1: 106,173,412 D470G possibly damaging Het
Prdm1 T C 10: 44,442,128 E248G probably benign Het
Prtg C T 9: 72,910,750 probably benign Het
Ptpn1 T C 2: 167,976,609 Y424H probably damaging Het
Ptprr T C 10: 116,256,204 V369A probably damaging Het
Rai1 T G 11: 60,185,395 V95G probably benign Het
Rasal3 T A 17: 32,393,535 probably null Het
Rbm19 A G 5: 120,122,896 E195G probably benign Het
Rhbdd3 T A 11: 5,103,332 L44Q probably damaging Het
Ripply2 T C 9: 87,019,660 W80R probably damaging Het
Rnf183 A G 4: 62,428,523 C13R probably damaging Het
Rorb A G 19: 18,955,053 L367P probably damaging Het
Rpl7a-ps5 C T 17: 57,839,140 probably benign Het
Rreb1 A G 13: 37,930,605 N647D probably benign Het
Rtn1 A T 12: 72,304,413 S341T probably damaging Het
Ryr3 T C 2: 112,757,701 S2632G probably benign Het
Scube1 A G 15: 83,615,026 C633R possibly damaging Het
Sdk1 A T 5: 142,038,323 I723F probably damaging Het
Sec23a A T 12: 59,002,010 C109S probably damaging Het
Sept11 T C 5: 93,148,428 F60L probably damaging Het
Sgf29 G A 7: 126,671,891 probably null Het
Skint5 A G 4: 113,556,111 probably benign Het
Smo G A 6: 29,755,483 V385I possibly damaging Het
Tada2a G A 11: 84,110,011 T76I probably damaging Het
Tas2r118 T A 6: 23,969,423 H213L possibly damaging Het
Thoc5 A T 11: 4,911,427 probably benign Het
Tmem33 T A 5: 67,267,291 probably null Het
Top1mt A G 15: 75,674,398 L78P probably damaging Het
Uvssa T A 5: 33,413,884 probably benign Het
Vmn2r50 A T 7: 10,050,135 C137* probably null Het
Vmn2r81 A G 10: 79,293,857 T861A probably benign Het
Wnt3 A T 11: 103,808,251 N61I probably damaging Het
Zswim9 A G 7: 13,277,218 I68T possibly damaging Het
Zzef1 T C 11: 72,912,945 I2535T probably damaging Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1282:Exoc3 UTSW 13 74182292 missense probably benign 0.30
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R1915:Exoc3 UTSW 13 74173294 critical splice donor site probably null
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4272:Exoc3 UTSW 13 74192644 missense probably damaging 1.00
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
R8098:Exoc3 UTSW 13 74172152 missense probably benign
R8146:Exoc3 UTSW 13 74192665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCTAAGGTGGCTCATGCTCTC -3'
(R):5'- TGAATGCAAGCTCCCTATGCTTCTG -3'

Sequencing Primer
(F):5'- GGTACATGCCCAGACCATTTG -3'
(R):5'- AGTGGCCCCCAAATCCTTG -3'
Posted On2014-03-14