Incidental Mutation 'R1439:Pmepa1'
ID160830
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1439 (G1)
Quality Score92
Status Validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173228081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably benign
Transcript: ENSMUST00000036248
AA Change: I189T

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: I189T

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124124
Predicted Effect probably benign
Transcript: ENSMUST00000139306
AA Change: I227T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: I227T

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173234419 missense possibly damaging 0.73
R7640:Pmepa1 UTSW 2 173276163 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGATGGCCCGTTACTTTGCTG -3'
(R):5'- AGGTAAGACCAAGTCATGCCTCCC -3'

Sequencing Primer
(F):5'- TGGTGCTGGAAGGAGGAG -3'
(R):5'- CTCTGAATCTGGGGGAATCCAAC -3'
Posted On2014-03-14