Incidental Mutation 'R1439:Rad54b'
ID160832
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene NameRAD54 homolog B (S. cerevisiae)
SynonymsE130016E03Rik, E130016E03Rik
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1439 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11558922-11615805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11606152 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 520 (K520R)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070755
AA Change: K520R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: K520R

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148576
Predicted Effect probably benign
Transcript: ENSMUST00000178725
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11593765 missense probably benign
IGL00774:Rad54b APN 4 11593765 missense probably benign
IGL00956:Rad54b APN 4 11597833 missense probably damaging 0.98
IGL00961:Rad54b APN 4 11599699 missense probably damaging 1.00
IGL01064:Rad54b APN 4 11604866 missense probably damaging 1.00
IGL02150:Rad54b APN 4 11610502 missense probably damaging 1.00
IGL02326:Rad54b APN 4 11612713 missense probably damaging 1.00
IGL03105:Rad54b APN 4 11615569 missense probably benign 0.00
IGL03143:Rad54b APN 4 11599755 missense probably damaging 1.00
IGL03288:Rad54b APN 4 11569833 missense possibly damaging 0.83
P0033:Rad54b UTSW 4 11609285 unclassified probably benign
R0076:Rad54b UTSW 4 11609480 unclassified probably benign
R0094:Rad54b UTSW 4 11599681 missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11601702 missense probably damaging 0.98
R0441:Rad54b UTSW 4 11563394 missense probably benign 0.08
R0442:Rad54b UTSW 4 11609480 unclassified probably benign
R0442:Rad54b UTSW 4 11610362 missense probably benign 0.02
R0449:Rad54b UTSW 4 11606131 missense probably benign 0.43
R0519:Rad54b UTSW 4 11599809 missense probably damaging 1.00
R0843:Rad54b UTSW 4 11609471 critical splice donor site probably null
R1118:Rad54b UTSW 4 11563352 missense probably damaging 1.00
R1763:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R1812:Rad54b UTSW 4 11612770 missense probably damaging 1.00
R1854:Rad54b UTSW 4 11601669 missense probably damaging 1.00
R1917:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1918:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1919:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R2057:Rad54b UTSW 4 11606088 missense probably benign 0.08
R2386:Rad54b UTSW 4 11597874 missense probably benign
R2437:Rad54b UTSW 4 11606272 missense probably damaging 1.00
R4299:Rad54b UTSW 4 11597865 missense probably damaging 1.00
R4391:Rad54b UTSW 4 11615570 missense probably benign 0.00
R4672:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4673:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4826:Rad54b UTSW 4 11599753 missense probably damaging 1.00
R4930:Rad54b UTSW 4 11615579 missense probably damaging 0.99
R5796:Rad54b UTSW 4 11615446 missense probably benign 0.01
R5901:Rad54b UTSW 4 11595919 missense possibly damaging 0.84
R6185:Rad54b UTSW 4 11593804 missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11601577 missense probably benign
R6684:Rad54b UTSW 4 11583689 unclassified probably benign
R6821:Rad54b UTSW 4 11612777 missense probably damaging 1.00
R6947:Rad54b UTSW 4 11569859 missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11599755 missense probably damaging 1.00
R7361:Rad54b UTSW 4 11599782 missense probably damaging 1.00
R7483:Rad54b UTSW 4 11610372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCCACCACTTTCTCCC -3'
(R):5'- CTTCACAGAGCTGAACAAGAGGCAA -3'

Sequencing Primer
(F):5'- ACTTTCTCCCCCTAAAATCTGATAG -3'
(R):5'- AGGGTGGTTGCACAGCTTC -3'
Posted On2014-03-14