Mutagenetix > Incidental Mutations

Incidental Mutation 'R1439:Rad54b'

160832

Institutional Source

Beutler Lab

Gene Symbol

Rad54b

Ensembl Gene

ENSMUSG00000078773

Gene Name

RAD54 homolog B (S. cerevisiae)

Synonyms

E130016E03Rik, E130016E03Rik

MMRRC Submission

039494-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1439 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11558922-11615805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11606152 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 520 (K520R)

Ref Sequence

ENSEMBL: ENSMUSP00000066977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070755]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070755
AA Change: K520R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: K520R

Domain	Start	End	E-Value	Type
low complexity region	113	121	N/A	INTRINSIC
low complexity region	164	178	N/A	INTRINSIC
DEXDc	270	470	4.36e-36	SMART
HELICc	652	736	6.14e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144499

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148576

Predicted Effect

probably benign
Transcript: ENSMUST00000178725

Meta Mutation Damage Score

0.1411

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.4%
20x: 86.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	A	G	1: 89,843,186	N499S	probably damaging	Het
AI661453	C	A	17: 47,466,662		probably benign	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Alkbh1	A	G	12: 87,429,145	V289A	probably damaging	Het
Bnc2	C	T	4: 84,276,068	E1035K	probably benign	Het
C1s2	T	A	6: 124,630,167		probably benign	Het
C530008M17Rik	T	C	5: 76,840,910	V36A	probably damaging	Het
Cabin1	A	G	10: 75,656,806	I1885T	probably damaging	Het
Col22a1	A	G	15: 71,952,377		probably benign	Het
Cpne4	A	T	9: 104,989,632	T248S	probably damaging	Het
Cubn	T	C	2: 13,287,568	N3268S	probably damaging	Het
Ddx10	T	A	9: 53,240,487	K79N	probably damaging	Het
Dennd1a	A	C	2: 38,043,400	L131R	probably damaging	Het
Dnah9	T	C	11: 65,874,132	Y3862C	probably benign	Het
Eif3e	A	G	15: 43,278,428		probably benign	Het
Emsy	T	C	7: 98,600,841		probably benign	Het
Ep400	A	T	5: 110,685,478	D1959E	unknown	Het
Fpr-rs7	A	G	17: 20,113,607	I207T	probably benign	Het
Fubp3	C	A	2: 31,598,551	L140I	probably damaging	Het
Gas2l2	T	C	11: 83,427,472	D137G	probably damaging	Het
Git1	G	T	11: 77,506,418	R699L	possibly damaging	Het
Gnao1	T	A	8: 93,963,437	F27L	probably benign	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Itga6	T	G	2: 71,834,034	Y505D	probably damaging	Het
Itgad	A	T	7: 128,183,006	T205S	probably benign	Het
Jakmip3	A	T	7: 139,029,646	Y574F	probably benign	Het
Laptm5	G	T	4: 130,926,209		probably benign	Het
Mlana	A	T	19: 29,706,852	R71S	probably benign	Het
Mroh2a	G	C	1: 88,257,802	E1510D	probably damaging	Het
Mus81	G	C	19: 5,485,117	R295G	probably benign	Het
Ncapd3	T	A	9: 27,087,566		probably null	Het
Nectin1	A	G	9: 43,792,099	E218G	possibly damaging	Het
Nectin3	A	T	16: 46,448,394	Y548*	probably null	Het
Nif3l1	T	C	1: 58,447,943	F96S	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Obsl1	C	A	1: 75,486,784	E1755*	probably null	Het
Olfr1198	T	C	2: 88,746,834	E18G	possibly damaging	Het
Osbpl9	T	C	4: 109,101,156	D74G	probably damaging	Het
Osgin1	T	A	8: 119,443,113		probably null	Het
Otogl	A	G	10: 107,779,252	Y1931H	probably benign	Het
Pmepa1	A	G	2: 173,228,081	I227T	probably benign	Het
Pprc1	T	A	19: 46,063,736	N564K	possibly damaging	Het
Prkaa1	T	C	15: 5,164,744	F92S	probably damaging	Het
Ptprd	A	G	4: 76,066,200	F811L	probably damaging	Het
Rbfox1	A	G	16: 7,330,433	T269A	possibly damaging	Het
Rfwd3	T	C	8: 111,278,288	Y554C	probably damaging	Het
Rfx2	A	T	17: 56,787,720	V208E	probably damaging	Het
Rgs22	G	T	15: 36,025,793		probably benign	Het
Rrbp1	A	G	2: 143,955,112		probably null	Het
Ryr2	C	T	13: 11,714,503		probably benign	Het
Sbno1	A	G	5: 124,384,460		probably benign	Het
Secisbp2	T	C	13: 51,679,723		probably benign	Het
Sgsm2	C	A	11: 74,869,138	R58L	probably benign	Het
Slc25a36	A	C	9: 97,093,073		probably benign	Het
Spink4	A	G	4: 40,929,121	T49A	possibly damaging	Het
Steap3	A	T	1: 120,227,820	F470I	probably damaging	Het
Stk10	A	G	11: 32,617,919	Q907R	probably damaging	Het
Tdrd5	A	G	1: 156,277,487	V446A	probably damaging	Het
Tmem117	G	A	15: 95,094,597	M379I	probably benign	Het
Trappc12	A	G	12: 28,747,161	L124P	possibly damaging	Het
Trim9	G	A	12: 70,251,093	H613Y	probably damaging	Het
Trio	A	G	15: 27,897,914	W371R	probably damaging	Het
Ulk4	G	C	9: 121,266,258	H110D	possibly damaging	Het
Upb1	T	C	10: 75,439,942	V387A	probably benign	Het
Utrn	A	T	10: 12,744,049	I284N	possibly damaging	Het
Vmn2r111	C	A	17: 22,571,116	W303L	probably benign	Het
Vmn2r15	G	T	5: 109,294,087	P160Q	probably damaging	Het
Wdtc1	A	G	4: 133,301,807	S323P	probably benign	Het
Zfp846	T	A	9: 20,594,097	C418S	possibly damaging	Het
Zfyve26	G	T	12: 79,252,163	P441Q	probably benign	Het

Other mutations in Rad54b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Rad54b	APN	4	11593765	missense	probably benign
IGL00774:Rad54b	APN	4	11593765	missense	probably benign
IGL00956:Rad54b	APN	4	11597833	missense	probably damaging	0.98
IGL00961:Rad54b	APN	4	11599699	missense	probably damaging	1.00
IGL01064:Rad54b	APN	4	11604866	missense	probably damaging	1.00
IGL02150:Rad54b	APN	4	11610502	missense	probably damaging	1.00
IGL02326:Rad54b	APN	4	11612713	missense	probably damaging	1.00
IGL03105:Rad54b	APN	4	11615569	missense	probably benign	0.00
IGL03143:Rad54b	APN	4	11599755	missense	probably damaging	1.00
IGL03288:Rad54b	APN	4	11569833	missense	possibly damaging	0.83
P0033:Rad54b	UTSW	4	11609285	unclassified	probably benign
R0076:Rad54b	UTSW	4	11609480	unclassified	probably benign
R0094:Rad54b	UTSW	4	11599681	missense	possibly damaging	0.92
R0391:Rad54b	UTSW	4	11601702	missense	probably damaging	0.98
R0441:Rad54b	UTSW	4	11563394	missense	probably benign	0.08
R0442:Rad54b	UTSW	4	11609480	unclassified	probably benign
R0442:Rad54b	UTSW	4	11610362	missense	probably benign	0.02
R0449:Rad54b	UTSW	4	11606131	missense	probably benign	0.43
R0519:Rad54b	UTSW	4	11599809	missense	probably damaging	1.00
R0843:Rad54b	UTSW	4	11609471	critical splice donor site	probably null
R1118:Rad54b	UTSW	4	11563352	missense	probably damaging	1.00
R1763:Rad54b	UTSW	4	11604989	missense	possibly damaging	0.52
R1812:Rad54b	UTSW	4	11612770	missense	probably damaging	1.00
R1854:Rad54b	UTSW	4	11601669	missense	probably damaging	1.00
R1917:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R1918:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R1919:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R2057:Rad54b	UTSW	4	11606088	missense	probably benign	0.08
R2386:Rad54b	UTSW	4	11597874	missense	probably benign
R2437:Rad54b	UTSW	4	11606272	missense	probably damaging	1.00
R4299:Rad54b	UTSW	4	11597865	missense	probably damaging	1.00
R4391:Rad54b	UTSW	4	11615570	missense	probably benign	0.00
R4672:Rad54b	UTSW	4	11609449	missense	probably benign	0.05
R4673:Rad54b	UTSW	4	11609449	missense	probably benign	0.05
R4826:Rad54b	UTSW	4	11599753	missense	probably damaging	1.00
R4930:Rad54b	UTSW	4	11615579	missense	probably damaging	0.99
R5796:Rad54b	UTSW	4	11615446	missense	probably benign	0.01
R5901:Rad54b	UTSW	4	11595919	missense	possibly damaging	0.84
R6185:Rad54b	UTSW	4	11593804	missense	possibly damaging	0.51
R6355:Rad54b	UTSW	4	11604989	missense	possibly damaging	0.52
R6576:Rad54b	UTSW	4	11601577	missense	probably benign
R6684:Rad54b	UTSW	4	11583689	unclassified	probably benign
R6821:Rad54b	UTSW	4	11612777	missense	probably damaging	1.00
R6947:Rad54b	UTSW	4	11569859	missense	possibly damaging	0.83
R7177:Rad54b	UTSW	4	11599755	missense	probably damaging	1.00
R7361:Rad54b	UTSW	4	11599782	missense	probably damaging	1.00
R7483:Rad54b	UTSW	4	11610372	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGAAGCCACCACTTTCTCCC -3'
(R):5'- CTTCACAGAGCTGAACAAGAGGCAA -3'

Sequencing Primer
(F):5'- ACTTTCTCCCCCTAAAATCTGATAG -3'
(R):5'- AGGGTGGTTGCACAGCTTC -3'

Posted On

2014-03-14