Incidental Mutation 'R1439:Ptprd'
ID160834
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Nameprotein tyrosine phosphatase, receptor type, D
Synonyms1110002J03Rik, 3000002J10Rik, B230219D21Rik
MMRRC Submission 039494-MU
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1439 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location75941238-78211961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76066200 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 811 (F811L)
Ref Sequence ENSEMBL: ENSMUSP00000134229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]
Predicted Effect probably damaging
Transcript: ENSMUST00000050757
AA Change: F807L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: F807L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098005
AA Change: F817L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: F817L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102834
AA Change: F570L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: F570L

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107289
AA Change: F1228L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: F1228L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173376
AA Change: F824L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: F824L

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174023
AA Change: F814L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: F814L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174180
AA Change: F1206L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: F1206L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174531
AA Change: F811L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: F811L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174831
AA Change: F817L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: F817L

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212365
AA Change: F137L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3440 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 unclassified probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
unhurried UTSW 4 76100633 nonsense probably null
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4799:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4950:Ptprd UTSW 4 76140515 splice site probably null
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5543:Ptprd UTSW 4 76059753 missense probably damaging 1.00
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 unclassified probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 intron probably null
R7131:Ptprd UTSW 4 76066340 missense probably damaging 1.00
R7170:Ptprd UTSW 4 76071962 missense probably benign 0.06
R7233:Ptprd UTSW 4 76059783 missense probably benign 0.00
R7246:Ptprd UTSW 4 76128676 missense probably damaging 1.00
R7413:Ptprd UTSW 4 76246839 missense probably benign 0.00
R7428:Ptprd UTSW 4 76086468 missense probably benign 0.03
R7442:Ptprd UTSW 4 76059821 nonsense probably null
R7491:Ptprd UTSW 4 76133155 missense probably benign 0.23
R7526:Ptprd UTSW 4 76066327 missense probably benign 0.00
R7609:Ptprd UTSW 4 76072003 missense probably benign 0.03
R7612:Ptprd UTSW 4 76086459 missense probably benign 0.45
R7659:Ptprd UTSW 4 76128916 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCACTCAGTAATTTTGGAAGGACAAGC -3'
(R):5'- GGCCCTTGCAAATCAGTTTAGCATC -3'

Sequencing Primer
(F):5'- TTTTGGAAGGACAAGCAACTC -3'
(R):5'- TTGCAAATCACAACGGAGTGTC -3'
Posted On2014-03-14