Incidental Mutation 'R1439:Trappc12'
ID160867
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Nametrafficking protein particle complex 12
SynonymsTtc15, D930014A20Rik, CGI-87
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R1439 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28690628-28750472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28747161 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 124 (L124P)
Ref Sequence ENSEMBL: ENSMUSP00000127752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000035657] [ENSMUST00000168129] [ENSMUST00000170994] [ENSMUST00000221555] [ENSMUST00000221877] [ENSMUST00000222407]
Predicted Effect probably benign
Transcript: ENSMUST00000020954
AA Change: L124P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035657
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168129
AA Change: L124P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170994
AA Change: L124P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132009
Gene: ENSMUSG00000020628
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221335
Predicted Effect probably benign
Transcript: ENSMUST00000221555
Predicted Effect probably benign
Transcript: ENSMUST00000221877
Predicted Effect probably benign
Transcript: ENSMUST00000222407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223552
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Trio A G 15: 27,897,914 W371R probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28737836 missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28691854 splice site probably benign
IGL01295:Trappc12 APN 12 28746762 missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28747402 missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28746915 missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28692492 critical splice donor site probably null
IGL02851:Trappc12 APN 12 28691406 missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28747014 missense probably benign
IGL03163:Trappc12 APN 12 28746654 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28747260 missense probably benign 0.00
R0517:Trappc12 UTSW 12 28697134 splice site probably benign
R0837:Trappc12 UTSW 12 28703597 missense possibly damaging 0.92
R1477:Trappc12 UTSW 12 28737752 missense probably benign 0.25
R1651:Trappc12 UTSW 12 28691777 missense probably benign 0.32
R1899:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R1900:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28746598 missense probably benign 0.00
R2174:Trappc12 UTSW 12 28747381 missense possibly damaging 0.94
R4449:Trappc12 UTSW 12 28747235 missense probably benign 0.05
R5031:Trappc12 UTSW 12 28692513 missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28737794 missense probably benign 0.03
R5220:Trappc12 UTSW 12 28746697 missense probably damaging 0.97
R5458:Trappc12 UTSW 12 28746390 missense probably damaging 0.98
R5471:Trappc12 UTSW 12 28691500 missense probably damaging 1.00
R5482:Trappc12 UTSW 12 28691325 missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28746864 missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28691514 missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28747114 missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28747083 missense probably damaging 0.97
R7669:Trappc12 UTSW 12 28711958 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTTCACCATCTGGGACTCGAAGCC -3'
(R):5'- TGCATCTGAAGAGAACGAGCCCAC -3'

Sequencing Primer
(F):5'- CCATCCTGTAGAAACAGGTGTG -3'
(R):5'- AAGGGTCTCACAACTTCGG -3'
Posted On2014-03-14