Incidental Mutation 'R1439:Trio'
ID160874
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 039494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1439 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27897914 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 371 (W371R)
Ref Sequence ENSEMBL: ENSMUSP00000154653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226775] [ENSMUST00000227337]
Predicted Effect unknown
Transcript: ENSMUST00000090247
AA Change: W430R
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: W430R

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226775
Predicted Effect probably damaging
Transcript: ENSMUST00000227337
AA Change: W371R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9691 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,843,186 N499S probably damaging Het
AI661453 C A 17: 47,466,662 probably benign Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Alkbh1 A G 12: 87,429,145 V289A probably damaging Het
Bnc2 C T 4: 84,276,068 E1035K probably benign Het
C1s2 T A 6: 124,630,167 probably benign Het
C530008M17Rik T C 5: 76,840,910 V36A probably damaging Het
Cabin1 A G 10: 75,656,806 I1885T probably damaging Het
Col22a1 A G 15: 71,952,377 probably benign Het
Cpne4 A T 9: 104,989,632 T248S probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Ddx10 T A 9: 53,240,487 K79N probably damaging Het
Dennd1a A C 2: 38,043,400 L131R probably damaging Het
Dnah9 T C 11: 65,874,132 Y3862C probably benign Het
Eif3e A G 15: 43,278,428 probably benign Het
Emsy T C 7: 98,600,841 probably benign Het
Ep400 A T 5: 110,685,478 D1959E unknown Het
Fpr-rs7 A G 17: 20,113,607 I207T probably benign Het
Fubp3 C A 2: 31,598,551 L140I probably damaging Het
Gas2l2 T C 11: 83,427,472 D137G probably damaging Het
Git1 G T 11: 77,506,418 R699L possibly damaging Het
Gnao1 T A 8: 93,963,437 F27L probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga6 T G 2: 71,834,034 Y505D probably damaging Het
Itgad A T 7: 128,183,006 T205S probably benign Het
Jakmip3 A T 7: 139,029,646 Y574F probably benign Het
Laptm5 G T 4: 130,926,209 probably benign Het
Mlana A T 19: 29,706,852 R71S probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Ncapd3 T A 9: 27,087,566 probably null Het
Nectin1 A G 9: 43,792,099 E218G possibly damaging Het
Nectin3 A T 16: 46,448,394 Y548* probably null Het
Nif3l1 T C 1: 58,447,943 F96S probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Obsl1 C A 1: 75,486,784 E1755* probably null Het
Olfr1198 T C 2: 88,746,834 E18G possibly damaging Het
Osbpl9 T C 4: 109,101,156 D74G probably damaging Het
Osgin1 T A 8: 119,443,113 probably null Het
Otogl A G 10: 107,779,252 Y1931H probably benign Het
Pmepa1 A G 2: 173,228,081 I227T probably benign Het
Pprc1 T A 19: 46,063,736 N564K possibly damaging Het
Prkaa1 T C 15: 5,164,744 F92S probably damaging Het
Ptprd A G 4: 76,066,200 F811L probably damaging Het
Rad54b A G 4: 11,606,152 K520R possibly damaging Het
Rbfox1 A G 16: 7,330,433 T269A possibly damaging Het
Rfwd3 T C 8: 111,278,288 Y554C probably damaging Het
Rfx2 A T 17: 56,787,720 V208E probably damaging Het
Rgs22 G T 15: 36,025,793 probably benign Het
Rrbp1 A G 2: 143,955,112 probably null Het
Ryr2 C T 13: 11,714,503 probably benign Het
Sbno1 A G 5: 124,384,460 probably benign Het
Secisbp2 T C 13: 51,679,723 probably benign Het
Sgsm2 C A 11: 74,869,138 R58L probably benign Het
Slc25a36 A C 9: 97,093,073 probably benign Het
Spink4 A G 4: 40,929,121 T49A possibly damaging Het
Steap3 A T 1: 120,227,820 F470I probably damaging Het
Stk10 A G 11: 32,617,919 Q907R probably damaging Het
Tdrd5 A G 1: 156,277,487 V446A probably damaging Het
Tmem117 G A 15: 95,094,597 M379I probably benign Het
Trappc12 A G 12: 28,747,161 L124P possibly damaging Het
Trim9 G A 12: 70,251,093 H613Y probably damaging Het
Ulk4 G C 9: 121,266,258 H110D possibly damaging Het
Upb1 T C 10: 75,439,942 V387A probably benign Het
Utrn A T 10: 12,744,049 I284N possibly damaging Het
Vmn2r111 C A 17: 22,571,116 W303L probably benign Het
Vmn2r15 G T 5: 109,294,087 P160Q probably damaging Het
Wdtc1 A G 4: 133,301,807 S323P probably benign Het
Zfp846 T A 9: 20,594,097 C418S possibly damaging Het
Zfyve26 G T 12: 79,252,163 P441Q probably benign Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTACTTTGGGCACACCTGCAATC -3'
(R):5'- GGGAACTGTCAGCAGGCTATTCAC -3'

Sequencing Primer
(F):5'- CTCTCTGTGAGGCTGAGTAAATCC -3'
(R):5'- TCAGCAGGCTATTCACCAAGG -3'
Posted On2014-03-14