Incidental Mutation 'R1439:Fpr-rs7'
ID 160881
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 039494-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R1439 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20333869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: I207T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: I207T

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176711
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,770,908 (GRCm39) N499S probably damaging Het
AI661453 C A 17: 47,777,587 (GRCm39) probably benign Het
Akap1 C A 11: 88,735,577 (GRCm39) G362* probably null Het
Alkbh1 A G 12: 87,475,915 (GRCm39) V289A probably damaging Het
Bnc2 C T 4: 84,194,305 (GRCm39) E1035K probably benign Het
C1s2 T A 6: 124,607,126 (GRCm39) probably benign Het
Cabin1 A G 10: 75,492,640 (GRCm39) I1885T probably damaging Het
Col22a1 A G 15: 71,824,226 (GRCm39) probably benign Het
Cpne4 A T 9: 104,866,831 (GRCm39) T248S probably damaging Het
Cracd T C 5: 76,988,757 (GRCm39) V36A probably damaging Het
Cubn T C 2: 13,292,379 (GRCm39) N3268S probably damaging Het
Ddx10 T A 9: 53,151,787 (GRCm39) K79N probably damaging Het
Dennd1a A C 2: 37,933,412 (GRCm39) L131R probably damaging Het
Dnah9 T C 11: 65,764,958 (GRCm39) Y3862C probably benign Het
Eif3e A G 15: 43,141,824 (GRCm39) probably benign Het
Emsy T C 7: 98,250,048 (GRCm39) probably benign Het
Ep400 A T 5: 110,833,344 (GRCm39) D1959E unknown Het
Fubp3 C A 2: 31,488,563 (GRCm39) L140I probably damaging Het
Gas2l2 T C 11: 83,318,298 (GRCm39) D137G probably damaging Het
Git1 G T 11: 77,397,244 (GRCm39) R699L possibly damaging Het
Gnao1 T A 8: 94,690,065 (GRCm39) F27L probably benign Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Itga6 T G 2: 71,664,378 (GRCm39) Y505D probably damaging Het
Itgad A T 7: 127,782,178 (GRCm39) T205S probably benign Het
Jakmip3 A T 7: 138,631,375 (GRCm39) Y574F probably benign Het
Laptm5 G T 4: 130,653,520 (GRCm39) probably benign Het
Mlana A T 19: 29,684,252 (GRCm39) R71S probably benign Het
Mroh2a G C 1: 88,185,524 (GRCm39) E1510D probably damaging Het
Mus81 G C 19: 5,535,145 (GRCm39) R295G probably benign Het
Ncapd3 T A 9: 26,998,862 (GRCm39) probably null Het
Nectin1 A G 9: 43,703,396 (GRCm39) E218G possibly damaging Het
Nectin3 A T 16: 46,268,757 (GRCm39) Y548* probably null Het
Nif3l1 T C 1: 58,487,102 (GRCm39) F96S probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Obsl1 C A 1: 75,463,428 (GRCm39) E1755* probably null Het
Or4p23 T C 2: 88,577,178 (GRCm39) E18G possibly damaging Het
Osbpl9 T C 4: 108,958,353 (GRCm39) D74G probably damaging Het
Osgin1 T A 8: 120,169,852 (GRCm39) probably null Het
Otogl A G 10: 107,615,113 (GRCm39) Y1931H probably benign Het
Pmepa1 A G 2: 173,069,874 (GRCm39) I227T probably benign Het
Pprc1 T A 19: 46,052,175 (GRCm39) N564K possibly damaging Het
Prkaa1 T C 15: 5,194,225 (GRCm39) F92S probably damaging Het
Ptprd A G 4: 75,984,437 (GRCm39) F811L probably damaging Het
Rad54b A G 4: 11,606,152 (GRCm39) K520R possibly damaging Het
Rbfox1 A G 16: 7,148,297 (GRCm39) T269A possibly damaging Het
Rfwd3 T C 8: 112,004,920 (GRCm39) Y554C probably damaging Het
Rfx2 A T 17: 57,094,720 (GRCm39) V208E probably damaging Het
Rgs22 G T 15: 36,025,939 (GRCm39) probably benign Het
Rrbp1 A G 2: 143,797,032 (GRCm39) probably null Het
Ryr2 C T 13: 11,729,389 (GRCm39) probably benign Het
Sbno1 A G 5: 124,522,523 (GRCm39) probably benign Het
Secisbp2 T C 13: 51,833,759 (GRCm39) probably benign Het
Sgsm2 C A 11: 74,759,964 (GRCm39) R58L probably benign Het
Slc25a36 A C 9: 96,975,126 (GRCm39) probably benign Het
Spink4 A G 4: 40,929,121 (GRCm39) T49A possibly damaging Het
Steap3 A T 1: 120,155,550 (GRCm39) F470I probably damaging Het
Stk10 A G 11: 32,567,919 (GRCm39) Q907R probably damaging Het
Tdrd5 A G 1: 156,105,057 (GRCm39) V446A probably damaging Het
Tmem117 G A 15: 94,992,478 (GRCm39) M379I probably benign Het
Trappc12 A G 12: 28,797,160 (GRCm39) L124P possibly damaging Het
Trim9 G A 12: 70,297,867 (GRCm39) H613Y probably damaging Het
Trio A G 15: 27,898,000 (GRCm39) W371R probably damaging Het
Ulk4 G C 9: 121,095,324 (GRCm39) H110D possibly damaging Het
Upb1 T C 10: 75,275,776 (GRCm39) V387A probably benign Het
Utrn A T 10: 12,619,793 (GRCm39) I284N possibly damaging Het
Vmn2r111 C A 17: 22,790,097 (GRCm39) W303L probably benign Het
Vmn2r15 G T 5: 109,441,953 (GRCm39) P160Q probably damaging Het
Wdtc1 A G 4: 133,029,118 (GRCm39) S323P probably benign Het
Zfp846 T A 9: 20,505,393 (GRCm39) C418S possibly damaging Het
Zfyve26 G T 12: 79,298,937 (GRCm39) P441Q probably benign Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1590:Fpr-rs7 UTSW 17 20,333,678 (GRCm39) missense probably benign 0.05
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R5959:Fpr-rs7 UTSW 17 20,334,011 (GRCm39) missense probably benign 0.01
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7921:Fpr-rs7 UTSW 17 20,333,667 (GRCm39) missense probably benign 0.03
R7984:Fpr-rs7 UTSW 17 20,333,671 (GRCm39) missense probably benign 0.01
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8172:Fpr-rs7 UTSW 17 20,334,443 (GRCm39) missense probably benign 0.04
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTCACTGTTCAGGGCTGAATCC -3'
(R):5'- TCATCGAACTGTGAATCTGGCAAGG -3'

Sequencing Primer
(F):5'- TCTCCAGACTAGCTGATAGGG -3'
(R):5'- ATCTGGCAAGGAAAGTGATTTTGG -3'
Posted On 2014-03-14