Incidental Mutation 'R1440:Col3a1'
ID160891
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Namecollagen, type III, alpha 1
SynonymsCol3a-1
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45311538-45349706 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 45343312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883] [ENSMUST00000186021]
Predicted Effect probably null
Transcript: ENSMUST00000087883
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185687
Predicted Effect probably benign
Transcript: ENSMUST00000186021
SMART Domains Protein: ENSMUSP00000139802
Gene: ENSMUSG00000026043

DomainStartEndE-ValueType
Pfam:Collagen 3 62 1.5e-11 PFAM
COLFI 96 244 7.9e-68 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Kraken UTSW 1 45327866 splice site probably null
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 unclassified probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
R7189:Col3a1 UTSW 1 45333657 missense unknown
R7194:Col3a1 UTSW 1 45331700 missense unknown
R7199:Col3a1 UTSW 1 45332141 missense probably null 0.99
R7204:Col3a1 UTSW 1 45322418 missense unknown
R7304:Col3a1 UTSW 1 45347811 missense unknown
R7398:Col3a1 UTSW 1 45327813 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAACTTCGGCTTCCACTAGGAC -3'
(R):5'- TCTTTCCAGATGGACCAACAGGGC -3'

Sequencing Primer
(F):5'- gcttccACTAGGACAGAGGG -3'
(R):5'- ACCAACAGGGCCAGGTG -3'
Posted On2014-03-14