Incidental Mutation 'R1440:Dock10'
ID160895
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R1440 (G1)
Quality Score221
Status Validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80549136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1124 (S1124A)
Ref Sequence ENSEMBL: ENSMUSP00000140085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: S1136A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: S1136A

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: S1124A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: S1124A

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190595
AA Change: S789A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: S789A

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: S1123A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: S1123A

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
R7359:Dock10 UTSW 1 80709348 missense probably benign 0.01
R7423:Dock10 UTSW 1 80523780 missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80540315 missense probably damaging 0.99
R7483:Dock10 UTSW 1 80515566 missense probably benign 0.01
R7487:Dock10 UTSW 1 80585048 missense probably benign 0.00
R7789:Dock10 UTSW 1 80559213 missense possibly damaging 0.82
RF021:Dock10 UTSW 1 80564573 critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAATTAAGATGGCAACCCCTGAA -3'
(R):5'- GCCTAGTCATCCCCAGCAGTGAATA -3'

Sequencing Primer
(F):5'- CCCCTGAAGGATAAAATACAAAGG -3'
(R):5'- GTATCTGAGTATAGACA -3'
Posted On2014-03-14