Incidental Mutation 'R1440:Cacna1e'
ID160898
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission 039495-MU
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154561806 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 328 (N328S)
Ref Sequence ENSEMBL: ENSMUSP00000140937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004214
AA Change: N20S

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: N20S

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187541
AA Change: N328S

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: N328S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188965
Predicted Effect possibly damaging
Transcript: ENSMUST00000211821
AA Change: N266S

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.5528 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154403683 missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4510:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4727:Cacna1e UTSW 1 154436468 nonsense probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154725709 missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 splice site probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
R7332:Cacna1e UTSW 1 154725801 missense possibly damaging 0.89
R7410:Cacna1e UTSW 1 154472234 missense probably benign 0.13
R7502:Cacna1e UTSW 1 154468988 missense probably null 0.35
R7556:Cacna1e UTSW 1 154472673 missense probably benign 0.28
R7563:Cacna1e UTSW 1 154471416 missense probably benign 0.00
R7573:Cacna1e UTSW 1 154726165 intron probably benign
R7689:Cacna1e UTSW 1 154398803 missense probably benign 0.01
R7699:Cacna1e UTSW 1 154443928 missense probably damaging 1.00
R7744:Cacna1e UTSW 1 154465792 missense probably damaging 1.00
R7754:Cacna1e UTSW 1 154413117 missense probably damaging 0.97
R7787:Cacna1e UTSW 1 154482568 missense probably damaging 0.98
R7818:Cacna1e UTSW 1 154398406 missense probably damaging 1.00
R7838:Cacna1e UTSW 1 154471403 missense probably benign 0.08
R7849:Cacna1e UTSW 1 154633718 missense probably damaging 1.00
R8011:Cacna1e UTSW 1 154465822 missense probably benign 0.01
R8094:Cacna1e UTSW 1 154561770 missense probably damaging 1.00
R8162:Cacna1e UTSW 1 154701567 splice site probably null
R8202:Cacna1e UTSW 1 154398449 missense probably benign
R8280:Cacna1e UTSW 1 154469093 missense probably damaging 0.97
R8354:Cacna1e UTSW 1 154398568 missense probably damaging 1.00
R8385:Cacna1e UTSW 1 154443941 missense probably damaging 0.98
R8532:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
RF008:Cacna1e UTSW 1 154442136 missense probably damaging 1.00
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Z1176:Cacna1e UTSW 1 154635850 missense probably damaging 0.98
Z1177:Cacna1e UTSW 1 154442292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATAGCTGGGATAACACTGGCAC -3'
(R):5'- TGATGTGGCCTTCACTAGGCACAG -3'

Sequencing Primer
(F):5'- TAACACTGGCACAAGGGTCTG -3'
(R):5'- CTTCACTAGGCACAGGGTAAAATG -3'
Posted On2014-03-14