Mutagenetix > Incidental Mutations

Incidental Mutation 'R1440:Snx5'

160904

Institutional Source

Beutler Lab

Gene Symbol

Snx5

Ensembl Gene

ENSMUSG00000027423

Gene Name

sorting nexin 5

Synonyms

D2Ertd52e, 0910001N05Rik, 1810032P22Rik

MMRRC Submission

039495-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R1440 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144250123-144270906 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 144254811 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 278 (K278T)

Ref Sequence

ENSEMBL: ENSMUSP00000105657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028909] [ENSMUST00000110030]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028909
AA Change: K278T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423
AA Change: K278T

Domain	Start	End	E-Value	Type
PX	31	169	1.85e-2	SMART
Pfam:Vps5	179	398	6.3e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110030
AA Change: K278T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423
AA Change: K278T

Domain	Start	End	E-Value	Type
PX	31	169	1.85e-2	SMART
Pfam:Vps5	179	398	1.7e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124389

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153033

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156936

Meta Mutation Damage Score

0.3199

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 84.7%

Validation Efficiency

95% (94/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein functions in endosomal sorting, the phosphoinositide-signaling pathway, and macropinocytosis. This gene may play a role in the tumorigenesis of papillary thyroid carcinoma. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired alveolar epithelial differentiation of type I cells, respiratory failure and lethality during the perinatal and postnatal periods. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	T	G	12: 72,881,421	N512T	possibly damaging	Het
Aadacl2	A	T	3: 60,024,892	H276L	probably damaging	Het
Adam12	G	A	7: 133,931,814	T445M	probably benign	Het
Ash2l	A	T	8: 25,827,378	F290L	probably benign	Het
Asxl3	C	T	18: 22,525,224	P2097L	probably benign	Het
Atmin	A	G	8: 116,957,376	I592V	probably damaging	Het
Atxn2	T	C	5: 121,803,082		probably null	Het
BC004004	T	C	17: 29,296,691		probably null	Het
Cacna1e	T	C	1: 154,561,806	N328S	possibly damaging	Het
Cacna2d1	A	T	5: 16,355,495	K765I	probably damaging	Het
Cc2d1a	A	G	8: 84,133,975		probably null	Het
Ccdc28b	A	G	4: 129,620,615	V198A	probably benign	Het
Ces1b	G	T	8: 93,068,108	R288S	probably damaging	Het
Cfap100	T	G	6: 90,412,184	T198P	probably benign	Het
Clint1	T	C	11: 45,890,783	S227P	probably damaging	Het
Cntn5	C	A	9: 10,145,339	C122F	probably damaging	Het
Col3a1	A	G	1: 45,343,312		probably null	Het
Cyp4a10	A	C	4: 115,529,449	D431A	probably damaging	Het
Cyp4f16	CTATG	CTATGTATG	17: 32,550,734		probably null	Het
Dlc1	A	T	8: 36,593,463		probably benign	Het
Dlgap2	T	C	8: 14,727,060	S102P	probably benign	Het
Dnah7b	G	A	1: 46,078,593		probably benign	Het
Dock10	A	C	1: 80,549,136	S1124A	probably benign	Het
Dscam	C	T	16: 96,819,951	R519H	probably damaging	Het
Efcab3	A	T	11: 105,108,755		probably benign	Het
Evi2a	G	T	11: 79,527,270	N171K	probably damaging	Het
Fbxl15	T	C	19: 46,330,245	L286P	probably damaging	Het
Fpr1	T	A	17: 17,877,263	I155F	probably benign	Het
Gcat	C	T	15: 79,033,994	A84V	probably null	Het
Gls	A	G	1: 52,191,134	F473L	possibly damaging	Het
Gnat1	T	C	9: 107,676,965	D169G	probably damaging	Het
Grm3	A	C	5: 9,589,958	M29R	probably benign	Het
Herc1	A	T	9: 66,467,803	D3303V	probably damaging	Het
Ibsp	G	A	5: 104,310,539	G314D	unknown	Het
Lgr6	C	A	1: 134,987,472	A513S	probably damaging	Het
Lrmp	C	T	6: 145,174,511	T484M	possibly damaging	Het
Lrriq4	T	A	3: 30,650,761	C313S	probably damaging	Het
March10	G	T	11: 105,390,583	T292K	probably damaging	Het
Mcoln2	C	A	3: 146,190,382	Y6*	probably null	Het
Mup4	A	G	4: 59,958,076	I164T	probably damaging	Het
Myo1b	T	C	1: 51,778,558		probably benign	Het
Ncam1	A	G	9: 49,544,800	I506T	probably damaging	Het
Notch1	A	T	2: 26,480,964		probably benign	Het
Nr4a3	A	T	4: 48,051,777	Q177L	probably benign	Het
Nsun4	A	G	4: 116,052,950	S138P	possibly damaging	Het
Olfr11	G	T	13: 21,639,390	N44K	probably benign	Het
Olfr403	A	G	11: 74,195,679	M59V	probably damaging	Het
Olfr716	A	T	7: 107,148,198	N294I	probably damaging	Het
Olfr729	T	C	14: 50,148,358	N172S	probably damaging	Het
Pagr1a	A	T	7: 127,016,297		probably benign	Het
Pcdhb2	A	T	18: 37,296,290	I82L	probably benign	Het
Pds5b	A	T	5: 150,754,417	N500I	probably damaging	Het
Pik3r6	A	T	11: 68,531,445	E223D	possibly damaging	Het
Pkhd1l1	A	T	15: 44,540,988		probably benign	Het
Prex1	T	C	2: 166,580,463	D1204G	probably damaging	Het
Prickle1	C	T	15: 93,505,074	E244K	possibly damaging	Het
Ptprd	A	T	4: 76,084,552	V211E	probably damaging	Het
Rad51d	G	A	11: 82,890,353	R23*	probably null	Het
Rapgef6	G	A	11: 54,626,708	G262R	probably damaging	Het
Reln	A	G	5: 22,128,602		probably benign	Het
Rev1	T	C	1: 38,088,205	T325A	probably damaging	Het
Rnd3	T	A	2: 51,132,506	I175L	probably benign	Het
Rp1	C	A	1: 4,347,396	L1164F	probably damaging	Het
S100a7a	T	C	3: 90,655,635	V43A	probably benign	Het
Scaper	A	C	9: 55,602,918	Y1104*	probably null	Het
Scn2a	T	A	2: 65,764,594	V1929D	probably benign	Het
Scn3a	T	C	2: 65,529,441	N141S	possibly damaging	Het
Slc12a7	T	G	13: 73,801,008	L718R	probably damaging	Het
Slc15a2	T	C	16: 36,784,643		probably benign	Het
Slc35b3	G	A	13: 38,954,134	Q100*	probably null	Het
Slc9a5	T	A	8: 105,355,153	V170E	possibly damaging	Het
Sorbs2	T	C	8: 45,789,963		probably benign	Het
Stab1	C	T	14: 31,151,690	W1008*	probably null	Het
Stab2	C	T	10: 86,861,367		probably null	Het
Tacc3	A	G	5: 33,667,977	E377G	probably benign	Het
Tango6	T	C	8: 106,689,039	L164P	probably damaging	Het
Tbc1d12	T	A	19: 38,914,352	S570T	possibly damaging	Het
Thbs1	T	C	2: 118,114,355	F217L	probably damaging	Het
Tmbim6	T	A	15: 99,402,123	V40E	probably damaging	Het
Tmigd1	A	T	11: 76,910,160	N158Y	probably damaging	Het
Top3b	C	T	16: 16,892,777	R824*	probably null	Het
Tram1l1	A	T	3: 124,321,931	K247*	probably null	Het
Tsc2	T	C	17: 24,614,392	Y686C	probably damaging	Het
Tsga10	T	C	1: 37,819,599	Q218R	probably damaging	Het
Uba6	G	T	5: 86,140,423	A439D	probably damaging	Het
Ubn1	C	A	16: 5,077,294	P735T	probably damaging	Het
Usp40	A	G	1: 87,982,086	S549P	probably benign	Het
Utp20	T	C	10: 88,819,339	T176A	probably benign	Het
Utp4	T	G	8: 106,898,053		probably benign	Het
Xpo5	C	T	17: 46,207,927		probably benign	Het
Zfp979	A	T	4: 147,614,036	I72K	possibly damaging	Het

Other mutations in Snx5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Snx5	APN	2	144255565	missense	probably benign
IGL01739:Snx5	APN	2	144270405	missense	probably benign	0.00
IGL03394:Snx5	APN	2	144253754	missense	probably damaging	1.00
R0052:Snx5	UTSW	2	144259192	splice site	probably null
R0052:Snx5	UTSW	2	144259192	splice site	probably null
R0344:Snx5	UTSW	2	144257208	splice site	probably benign
R0848:Snx5	UTSW	2	144253806	missense	probably damaging	0.98
R2282:Snx5	UTSW	2	144253675	missense	probably benign	0.03
R3830:Snx5	UTSW	2	144254901	critical splice donor site	probably null
R5727:Snx5	UTSW	2	144260754	missense	probably benign	0.00
R6048:Snx5	UTSW	2	144259153	missense	probably damaging	0.97
R7497:Snx5	UTSW	2	144257974	missense	probably damaging	0.99
R7664:Snx5	UTSW	2	144258004	splice site	probably null
R7895:Snx5	UTSW	2	144253820	missense	possibly damaging	0.90
R8098:Snx5	UTSW	2	144255562	missense	probably benign	0.00
Z1088:Snx5	UTSW	2	144252491	missense	probably benign	0.29
Z1177:Snx5	UTSW	2	144259079	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCACTGAGCCATGACCTAGAAC -3'
(R):5'- GCTAAGACCTTGAACTGTGACCTTCC -3'

Sequencing Primer
(F):5'- tcttcacatatcacacacaacac -3'
(R):5'- TGAACTGTGACCTTCCTTCTG -3'

Posted On

2014-03-14