Incidental Mutation 'R1440:Lrriq4'
ID160906
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Nameleucine-rich repeats and IQ motif containing 4
Synonyms4930558O21Rik
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1440 (G1)
Quality Score143
Status Validated
Chromosome3
Chromosomal Location30644507-30672431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30650761 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 313 (C313S)
Ref Sequence ENSEMBL: ENSMUSP00000127052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108265
AA Change: C298S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: C298S

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108267
AA Change: C313S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: C313S

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172350
AA Change: C313S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: C313S

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.2766 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30650955 splice site probably null
IGL01289:Lrriq4 APN 3 30650393 missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30650747 missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30655639 missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30655724 missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30650323 missense possibly damaging 0.46
R1446:Lrriq4 UTSW 3 30650578 missense probably benign 0.00
R1597:Lrriq4 UTSW 3 30650888 missense probably damaging 1.00
R1763:Lrriq4 UTSW 3 30650252 missense probably benign 0.19
R1923:Lrriq4 UTSW 3 30659093 missense probably benign 0.13
R4024:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4026:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30650743 missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30660047 missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30650937 missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30650483 missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30645332 start codon destroyed probably null
R5487:Lrriq4 UTSW 3 30659995 missense probably benign 0.16
R6147:Lrriq4 UTSW 3 30659079 missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30650402 missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30655733 missense probably damaging 1.00
R6624:Lrriq4 UTSW 3 30650780 missense probably benign 0.01
R7032:Lrriq4 UTSW 3 30655701 nonsense probably null
R8111:Lrriq4 UTSW 3 30655781 missense possibly damaging 0.87
Z1177:Lrriq4 UTSW 3 30649996 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACAACCTGGAGGTGATCGACCTG -3'
(R):5'- TCCTGGCACAACAAAGAAGGGC -3'

Sequencing Primer
(F):5'- ATATCGGGCACCTGGTGAG -3'
(R):5'- TTGTTATCATCTAGCGCCAGG -3'
Posted On2014-03-14