Incidental Mutation 'R1440:Ibsp'
ID160923
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Nameintegrin binding sialoprotein
SynonymsBsp2, bone sialoprotein, BSP
MMRRC Submission 039495-MU
Accession Numbers

Genbank: NM_008318.3

Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104299171-104311469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104310539 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 314 (G314D)
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
Predicted Effect unknown
Transcript: ENSMUST00000031246
AA Change: G314D
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: G314D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104310068 missense probably benign 0.27
IGL02317:Ibsp APN 5 104302466 missense probably damaging 1.00
IGL02539:Ibsp APN 5 104302283 missense probably damaging 0.99
IGL03236:Ibsp APN 5 104306005 missense probably benign 0.30
crunch UTSW 5 104309282 missense probably damaging 1.00
I2289:Ibsp UTSW 5 104302487 missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104302304 missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0234:Ibsp UTSW 5 104310069 small deletion probably benign
R0610:Ibsp UTSW 5 104310134 missense probably benign 0.07
R0656:Ibsp UTSW 5 104310020 critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104302152 missense probably damaging 0.99
R1569:Ibsp UTSW 5 104310151 missense probably damaging 1.00
R1921:Ibsp UTSW 5 104310212 missense probably damaging 1.00
R2172:Ibsp UTSW 5 104310430 missense probably damaging 1.00
R2879:Ibsp UTSW 5 104310394 missense possibly damaging 0.88
R4399:Ibsp UTSW 5 104309282 missense probably damaging 1.00
R4517:Ibsp UTSW 5 104305997 nonsense probably null
R5417:Ibsp UTSW 5 104310469 missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104310059 missense possibly damaging 0.78
R6183:Ibsp UTSW 5 104306030 missense possibly damaging 0.95
R6273:Ibsp UTSW 5 104310301 missense probably benign 0.15
R6295:Ibsp UTSW 5 104302121 splice site probably null
R7061:Ibsp UTSW 5 104309902 intron probably null
R7133:Ibsp UTSW 5 104302306 nonsense probably null
R7202:Ibsp UTSW 5 104302161 missense probably benign 0.02
R7205:Ibsp UTSW 5 104310431 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTTCTGAACGGGTTTCAGC -3'
(R):5'- AGCCTTCTTATACAGGGTATGTTTGCG -3'

Sequencing Primer
(F):5'- ACGGGTTTCAGCAGACAAC -3'
(R):5'- CATTTGCGGAAATCACTCTGG -3'
Posted On2014-03-14