Incidental Mutation 'R1440:Atxn2'
ID 160924
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 039495-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R1440 (G1)
Quality Score 214
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121941145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000161159] [ENSMUST00000162327] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160093
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162995
SMART Domains Protein: ENSMUSP00000124403
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 88 125 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161872
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,928,195 (GRCm39) N512T possibly damaging Het
Aadacl2 A T 3: 59,932,313 (GRCm39) H276L probably damaging Het
Adam12 G A 7: 133,533,543 (GRCm39) T445M probably benign Het
Ash2l A T 8: 26,317,406 (GRCm39) F290L probably benign Het
Asxl3 C T 18: 22,658,281 (GRCm39) P2097L probably benign Het
Atmin A G 8: 117,684,115 (GRCm39) I592V probably damaging Het
BC004004 T C 17: 29,515,665 (GRCm39) probably null Het
Cacna1e T C 1: 154,437,552 (GRCm39) N328S possibly damaging Het
Cacna2d1 A T 5: 16,560,493 (GRCm39) K765I probably damaging Het
Cc2d1a A G 8: 84,860,604 (GRCm39) probably null Het
Ccdc28b A G 4: 129,514,408 (GRCm39) V198A probably benign Het
Ces1b G T 8: 93,794,736 (GRCm39) R288S probably damaging Het
Cfap100 T G 6: 90,389,166 (GRCm39) T198P probably benign Het
Clint1 T C 11: 45,781,610 (GRCm39) S227P probably damaging Het
Cntn5 C A 9: 10,145,344 (GRCm39) C122F probably damaging Het
Col3a1 A G 1: 45,382,472 (GRCm39) probably null Het
Cyp4a10 A C 4: 115,386,646 (GRCm39) D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,769,708 (GRCm39) probably null Het
Dlc1 A T 8: 37,060,617 (GRCm39) probably benign Het
Dlgap2 T C 8: 14,777,060 (GRCm39) S102P probably benign Het
Dnah7b G A 1: 46,117,753 (GRCm39) probably benign Het
Dock10 A C 1: 80,526,853 (GRCm39) S1124A probably benign Het
Dscam C T 16: 96,621,151 (GRCm39) R519H probably damaging Het
Efcab3 A T 11: 104,999,581 (GRCm39) probably benign Het
Evi2a G T 11: 79,418,096 (GRCm39) N171K probably damaging Het
Fbxl15 T C 19: 46,318,684 (GRCm39) L286P probably damaging Het
Fpr1 T A 17: 18,097,525 (GRCm39) I155F probably benign Het
Gcat C T 15: 78,918,194 (GRCm39) A84V probably null Het
Gls A G 1: 52,230,293 (GRCm39) F473L possibly damaging Het
Gnat1 T C 9: 107,554,164 (GRCm39) D169G probably damaging Het
Grm3 A C 5: 9,639,958 (GRCm39) M29R probably benign Het
Herc1 A T 9: 66,375,085 (GRCm39) D3303V probably damaging Het
Ibsp G A 5: 104,458,405 (GRCm39) G314D unknown Het
Irag2 C T 6: 145,120,237 (GRCm39) T484M possibly damaging Het
Lgr6 C A 1: 134,915,210 (GRCm39) A513S probably damaging Het
Lrriq4 T A 3: 30,704,910 (GRCm39) C313S probably damaging Het
Marchf10 G T 11: 105,281,409 (GRCm39) T292K probably damaging Het
Mcoln2 C A 3: 145,896,137 (GRCm39) Y6* probably null Het
Mup4 A G 4: 59,958,076 (GRCm39) I164T probably damaging Het
Myo1b T C 1: 51,817,717 (GRCm39) probably benign Het
Ncam1 A G 9: 49,456,100 (GRCm39) I506T probably damaging Het
Notch1 A T 2: 26,370,976 (GRCm39) probably benign Het
Nr4a3 A T 4: 48,051,777 (GRCm39) Q177L probably benign Het
Nsun4 A G 4: 115,910,147 (GRCm39) S138P possibly damaging Het
Or1a1 A G 11: 74,086,505 (GRCm39) M59V probably damaging Het
Or2b6 G T 13: 21,823,560 (GRCm39) N44K probably benign Het
Or2d36 A T 7: 106,747,405 (GRCm39) N294I probably damaging Het
Or4k5 T C 14: 50,385,815 (GRCm39) N172S probably damaging Het
Pagr1a A T 7: 126,615,469 (GRCm39) probably benign Het
Pcdhb2 A T 18: 37,429,343 (GRCm39) I82L probably benign Het
Pds5b A T 5: 150,677,882 (GRCm39) N500I probably damaging Het
Pik3r6 A T 11: 68,422,271 (GRCm39) E223D possibly damaging Het
Pkhd1l1 A T 15: 44,404,384 (GRCm39) probably benign Het
Prex1 T C 2: 166,422,383 (GRCm39) D1204G probably damaging Het
Prickle1 C T 15: 93,402,955 (GRCm39) E244K possibly damaging Het
Ptprd A T 4: 76,002,789 (GRCm39) V211E probably damaging Het
Rad51d G A 11: 82,781,179 (GRCm39) R23* probably null Het
Rapgef6 G A 11: 54,517,534 (GRCm39) G262R probably damaging Het
Reln A G 5: 22,333,600 (GRCm39) probably benign Het
Rev1 T C 1: 38,127,286 (GRCm39) T325A probably damaging Het
Rnd3 T A 2: 51,022,518 (GRCm39) I175L probably benign Het
Rp1 C A 1: 4,417,619 (GRCm39) L1164F probably damaging Het
S100a7a T C 3: 90,562,942 (GRCm39) V43A probably benign Het
Scaper A C 9: 55,510,202 (GRCm39) Y1104* probably null Het
Scn2a T A 2: 65,594,938 (GRCm39) V1929D probably benign Het
Scn3a T C 2: 65,359,785 (GRCm39) N141S possibly damaging Het
Slc12a7 T G 13: 73,949,127 (GRCm39) L718R probably damaging Het
Slc15a2 T C 16: 36,605,005 (GRCm39) probably benign Het
Slc35b3 G A 13: 39,138,110 (GRCm39) Q100* probably null Het
Slc9a5 T A 8: 106,081,785 (GRCm39) V170E possibly damaging Het
Snx5 T G 2: 144,096,731 (GRCm39) K278T possibly damaging Het
Sorbs2 T C 8: 46,243,000 (GRCm39) probably benign Het
Stab1 C T 14: 30,873,647 (GRCm39) W1008* probably null Het
Stab2 C T 10: 86,697,231 (GRCm39) probably null Het
Tacc3 A G 5: 33,825,321 (GRCm39) E377G probably benign Het
Tango6 T C 8: 107,415,671 (GRCm39) L164P probably damaging Het
Tbc1d12 T A 19: 38,902,796 (GRCm39) S570T possibly damaging Het
Thbs1 T C 2: 117,944,836 (GRCm39) F217L probably damaging Het
Tmbim6 T A 15: 99,300,004 (GRCm39) V40E probably damaging Het
Tmigd1 A T 11: 76,800,986 (GRCm39) N158Y probably damaging Het
Top3b C T 16: 16,710,641 (GRCm39) R824* probably null Het
Tram1l1 A T 3: 124,115,580 (GRCm39) K247* probably null Het
Tsc2 T C 17: 24,833,366 (GRCm39) Y686C probably damaging Het
Tsga10 T C 1: 37,858,680 (GRCm39) Q218R probably damaging Het
Uba6 G T 5: 86,288,282 (GRCm39) A439D probably damaging Het
Ubn1 C A 16: 4,895,158 (GRCm39) P735T probably damaging Het
Usp40 A G 1: 87,909,808 (GRCm39) S549P probably benign Het
Utp20 T C 10: 88,655,201 (GRCm39) T176A probably benign Het
Utp4 T G 8: 107,624,685 (GRCm39) probably benign Het
Xpo5 C T 17: 46,518,853 (GRCm39) probably benign Het
Zfp979 A T 4: 147,698,493 (GRCm39) I72K possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGACTTCACATCGTTCATTTTGGCA -3'
(R):5'- ACACTCACTCTCACAAAGAGTCAGGTTA -3'

Sequencing Primer
(F):5'- GGCATAATGGATGTTCTTTTGTCTAC -3'
(R):5'- gtctctatgttgtctctcacctc -3'
Posted On 2014-03-14