Incidental Mutation 'R1440:Lrmp'
ID160926
Institutional Source Beutler Lab
Gene Symbol Lrmp
Ensembl Gene ENSMUSG00000030263
Gene Namelymphoid-restricted membrane protein
SynonymsD6Int8, D6Int7, D6Int5, D6Int4, D6Int3, Jaw1
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1440 (G1)
Quality Score177
Status Validated
Chromosome6
Chromosomal Location145115653-145174934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145174511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 484 (T484M)
Ref Sequence ENSEMBL: ENSMUSP00000032396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032396
AA Change: T484M

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263
AA Change: T484M

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably benign
Transcript: ENSMUST00000111728
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132937
Predicted Effect unknown
Transcript: ENSMUST00000132948
AA Change: T448M
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263
AA Change: T448M

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Lrmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Lrmp APN 6 145167994 missense probably damaging 1.00
IGL01066:Lrmp APN 6 145160955 missense probably damaging 1.00
IGL01877:Lrmp APN 6 145147799 missense probably damaging 0.99
IGL02154:Lrmp APN 6 145138241 missense possibly damaging 0.92
IGL02727:Lrmp APN 6 145174618 missense possibly damaging 0.78
FR4976:Lrmp UTSW 6 145173785 unclassified probably benign
R0238:Lrmp UTSW 6 145171978 unclassified probably benign
R0239:Lrmp UTSW 6 145171978 unclassified probably benign
R0454:Lrmp UTSW 6 145167984 missense possibly damaging 0.73
R0485:Lrmp UTSW 6 145165212 missense probably damaging 1.00
R0487:Lrmp UTSW 6 145165260 missense probably benign 0.02
R0554:Lrmp UTSW 6 145165287 missense probably benign 0.01
R0634:Lrmp UTSW 6 145174628 missense probably damaging 0.98
R1574:Lrmp UTSW 6 145158630 splice site probably benign
R1697:Lrmp UTSW 6 145137615 splice site probably benign
R1968:Lrmp UTSW 6 145169773 missense probably damaging 0.98
R3735:Lrmp UTSW 6 145160870 splice site probably benign
R3736:Lrmp UTSW 6 145160870 splice site probably benign
R4643:Lrmp UTSW 6 145168060 missense probably benign 0.17
R4812:Lrmp UTSW 6 145148011 missense probably damaging 1.00
R4916:Lrmp UTSW 6 145165301 missense probably damaging 1.00
R5183:Lrmp UTSW 6 145138220 missense probably benign 0.23
R5845:Lrmp UTSW 6 145171666 missense probably benign 0.00
R6701:Lrmp UTSW 6 145144976 nonsense probably null
R6735:Lrmp UTSW 6 145160893 missense probably damaging 1.00
R7083:Lrmp UTSW 6 145169783 missense probably damaging 1.00
R7317:Lrmp UTSW 6 145158698 missense possibly damaging 0.93
R7468:Lrmp UTSW 6 145173701 splice site probably null
R8429:Lrmp UTSW 6 145165223 missense probably damaging 1.00
R8485:Lrmp UTSW 6 145171674 missense probably damaging 1.00
RF003:Lrmp UTSW 6 145173783 unclassified probably benign
RF015:Lrmp UTSW 6 145173783 unclassified probably benign
RF017:Lrmp UTSW 6 145173784 unclassified probably benign
RF027:Lrmp UTSW 6 145173790 unclassified probably benign
RF029:Lrmp UTSW 6 145173790 unclassified probably benign
RF030:Lrmp UTSW 6 145173788 unclassified probably benign
RF030:Lrmp UTSW 6 145173790 unclassified probably benign
RF038:Lrmp UTSW 6 145173790 unclassified probably benign
RF043:Lrmp UTSW 6 145173790 unclassified probably benign
RF044:Lrmp UTSW 6 145173790 unclassified probably benign
RF048:Lrmp UTSW 6 145173784 unclassified probably benign
RF052:Lrmp UTSW 6 145160531 critical splice acceptor site probably benign
RF054:Lrmp UTSW 6 145173788 unclassified probably benign
RF055:Lrmp UTSW 6 145173785 unclassified probably benign
Z1177:Lrmp UTSW 6 145148074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACTAACCCTGCTTTGCTTGACTG -3'
(R):5'- CCATCATGCCCGAGTCTGGTAAATG -3'

Sequencing Primer
(F):5'- ATCCTAGCGTGCATCTAAGG -3'
(R):5'- ACCTGTGAGGAAGCTCATCA -3'
Posted On2014-03-14