Mutagenetix > Incidental Mutations

Incidental Mutation 'R1440:Gnat1'

160944

Institutional Source

Beutler Lab

Gene Symbol

Gnat1

Ensembl Gene

ENSMUSG00000034837

Gene Name

guanine nucleotide binding protein, alpha transducing 1

Synonyms

Gnat-1, Ird1, irdr, Ird2, transducin, Tralpha

MMRRC Submission

039495-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R1440 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107674474-107679712 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107676965 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 169 (D169G)

Ref Sequence

ENSEMBL: ENSMUSP00000010205 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000010205
AA Change: D169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837
AA Change: D169G

Domain	Start	End	E-Value	Type
G_alpha	9	349	5.13e-223	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000080560

SMART Domains

Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	57	498	5.46e-206	SMART
PSI	516	568	1.87e-12	SMART
IGc2	586	654	3.79e-4	SMART
low complexity region	673	695	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192271

SMART Domains

Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

Domain	Start	End	E-Value	Type
low complexity region	14	27	N/A	INTRINSIC
transmembrane domain	32	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193188

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195849

Meta Mutation Damage Score

0.9738

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 84.7%

Validation Efficiency

95% (94/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display retinal degeneration with age and abnormal electrophysiology of the rods. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	T	G	12: 72,881,421	N512T	possibly damaging	Het
Aadacl2	A	T	3: 60,024,892	H276L	probably damaging	Het
Adam12	G	A	7: 133,931,814	T445M	probably benign	Het
Ash2l	A	T	8: 25,827,378	F290L	probably benign	Het
Asxl3	C	T	18: 22,525,224	P2097L	probably benign	Het
Atmin	A	G	8: 116,957,376	I592V	probably damaging	Het
Atxn2	T	C	5: 121,803,082		probably null	Het
BC004004	T	C	17: 29,296,691		probably null	Het
Cacna1e	T	C	1: 154,561,806	N328S	possibly damaging	Het
Cacna2d1	A	T	5: 16,355,495	K765I	probably damaging	Het
Cc2d1a	A	G	8: 84,133,975		probably null	Het
Ccdc28b	A	G	4: 129,620,615	V198A	probably benign	Het
Ces1b	G	T	8: 93,068,108	R288S	probably damaging	Het
Cfap100	T	G	6: 90,412,184	T198P	probably benign	Het
Clint1	T	C	11: 45,890,783	S227P	probably damaging	Het
Cntn5	C	A	9: 10,145,339	C122F	probably damaging	Het
Col3a1	A	G	1: 45,343,312		probably null	Het
Cyp4a10	A	C	4: 115,529,449	D431A	probably damaging	Het
Cyp4f16	CTATG	CTATGTATG	17: 32,550,734		probably null	Het
Dlc1	A	T	8: 36,593,463		probably benign	Het
Dlgap2	T	C	8: 14,727,060	S102P	probably benign	Het
Dnah7b	G	A	1: 46,078,593		probably benign	Het
Dock10	A	C	1: 80,549,136	S1124A	probably benign	Het
Dscam	C	T	16: 96,819,951	R519H	probably damaging	Het
Efcab3	A	T	11: 105,108,755		probably benign	Het
Evi2a	G	T	11: 79,527,270	N171K	probably damaging	Het
Fbxl15	T	C	19: 46,330,245	L286P	probably damaging	Het
Fpr1	T	A	17: 17,877,263	I155F	probably benign	Het
Gcat	C	T	15: 79,033,994	A84V	probably null	Het
Gls	A	G	1: 52,191,134	F473L	possibly damaging	Het
Grm3	A	C	5: 9,589,958	M29R	probably benign	Het
Herc1	A	T	9: 66,467,803	D3303V	probably damaging	Het
Ibsp	G	A	5: 104,310,539	G314D	unknown	Het
Lgr6	C	A	1: 134,987,472	A513S	probably damaging	Het
Lrmp	C	T	6: 145,174,511	T484M	possibly damaging	Het
Lrriq4	T	A	3: 30,650,761	C313S	probably damaging	Het
March10	G	T	11: 105,390,583	T292K	probably damaging	Het
Mcoln2	C	A	3: 146,190,382	Y6*	probably null	Het
Mup4	A	G	4: 59,958,076	I164T	probably damaging	Het
Myo1b	T	C	1: 51,778,558		probably benign	Het
Ncam1	A	G	9: 49,544,800	I506T	probably damaging	Het
Notch1	A	T	2: 26,480,964		probably benign	Het
Nr4a3	A	T	4: 48,051,777	Q177L	probably benign	Het
Nsun4	A	G	4: 116,052,950	S138P	possibly damaging	Het
Olfr11	G	T	13: 21,639,390	N44K	probably benign	Het
Olfr403	A	G	11: 74,195,679	M59V	probably damaging	Het
Olfr716	A	T	7: 107,148,198	N294I	probably damaging	Het
Olfr729	T	C	14: 50,148,358	N172S	probably damaging	Het
Pagr1a	A	T	7: 127,016,297		probably benign	Het
Pcdhb2	A	T	18: 37,296,290	I82L	probably benign	Het
Pds5b	A	T	5: 150,754,417	N500I	probably damaging	Het
Pik3r6	A	T	11: 68,531,445	E223D	possibly damaging	Het
Pkhd1l1	A	T	15: 44,540,988		probably benign	Het
Prex1	T	C	2: 166,580,463	D1204G	probably damaging	Het
Prickle1	C	T	15: 93,505,074	E244K	possibly damaging	Het
Ptprd	A	T	4: 76,084,552	V211E	probably damaging	Het
Rad51d	G	A	11: 82,890,353	R23*	probably null	Het
Rapgef6	G	A	11: 54,626,708	G262R	probably damaging	Het
Reln	A	G	5: 22,128,602		probably benign	Het
Rev1	T	C	1: 38,088,205	T325A	probably damaging	Het
Rnd3	T	A	2: 51,132,506	I175L	probably benign	Het
Rp1	C	A	1: 4,347,396	L1164F	probably damaging	Het
S100a7a	T	C	3: 90,655,635	V43A	probably benign	Het
Scaper	A	C	9: 55,602,918	Y1104*	probably null	Het
Scn2a	T	A	2: 65,764,594	V1929D	probably benign	Het
Scn3a	T	C	2: 65,529,441	N141S	possibly damaging	Het
Slc12a7	T	G	13: 73,801,008	L718R	probably damaging	Het
Slc15a2	T	C	16: 36,784,643		probably benign	Het
Slc35b3	G	A	13: 38,954,134	Q100*	probably null	Het
Slc9a5	T	A	8: 105,355,153	V170E	possibly damaging	Het
Snx5	T	G	2: 144,254,811	K278T	possibly damaging	Het
Sorbs2	T	C	8: 45,789,963		probably benign	Het
Stab1	C	T	14: 31,151,690	W1008*	probably null	Het
Stab2	C	T	10: 86,861,367		probably null	Het
Tacc3	A	G	5: 33,667,977	E377G	probably benign	Het
Tango6	T	C	8: 106,689,039	L164P	probably damaging	Het
Tbc1d12	T	A	19: 38,914,352	S570T	possibly damaging	Het
Thbs1	T	C	2: 118,114,355	F217L	probably damaging	Het
Tmbim6	T	A	15: 99,402,123	V40E	probably damaging	Het
Tmigd1	A	T	11: 76,910,160	N158Y	probably damaging	Het
Top3b	C	T	16: 16,892,777	R824*	probably null	Het
Tram1l1	A	T	3: 124,321,931	K247*	probably null	Het
Tsc2	T	C	17: 24,614,392	Y686C	probably damaging	Het
Tsga10	T	C	1: 37,819,599	Q218R	probably damaging	Het
Uba6	G	T	5: 86,140,423	A439D	probably damaging	Het
Ubn1	C	A	16: 5,077,294	P735T	probably damaging	Het
Usp40	A	G	1: 87,982,086	S549P	probably benign	Het
Utp20	T	C	10: 88,819,339	T176A	probably benign	Het
Utp4	T	G	8: 106,898,053		probably benign	Het
Xpo5	C	T	17: 46,207,927		probably benign	Het
Zfp979	A	T	4: 147,614,036	I72K	possibly damaging	Het

Other mutations in Gnat1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01419:Gnat1	APN	9	107679434	splice site	probably null
IGL01514:Gnat1	APN	9	107676301	missense	possibly damaging	0.56
R0730:Gnat1	UTSW	9	107679463	missense	probably damaging	1.00
R1054:Gnat1	UTSW	9	107677439	missense	probably damaging	1.00
R1268:Gnat1	UTSW	9	107675877	unclassified	probably benign
R1824:Gnat1	UTSW	9	107676575	missense	probably damaging	1.00
R4964:Gnat1	UTSW	9	107677234	missense	probably benign	0.05
R4966:Gnat1	UTSW	9	107677234	missense	probably benign	0.05
R6355:Gnat1	UTSW	9	107677424	missense	probably benign	0.03
R7035:Gnat1	UTSW	9	107676628	unclassified	probably benign
R7218:Gnat1	UTSW	9	107675985	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GATGAAAATGATGCACGTCACACCC -3'
(R):5'- CGAGCCTCAGAATACCAGCTCAATG -3'

Sequencing Primer
(F):5'- ACATCGAACATTCTGTCGGG -3'
(R):5'- AGCTCAATGACTCCGCCG -3'

Posted On

2014-03-14