Incidental Mutation 'R1440:Stab2'
ID 160945
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 039495-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1440 (G1)
Quality Score 209
Status Validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation splice site (1 bp from exon)
DNA Base Change (assembly) C to T at 86697231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably null
Transcript: ENSMUST00000035288
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159445
Predicted Effect probably null
Transcript: ENSMUST00000161560
SMART Domains Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459

DomainStartEndE-ValueType
EGF 30 68 1.64e-1 SMART
EGF 72 110 1.14e0 SMART
EGF 114 152 5.62e0 SMART
FAS1 187 283 2.23e-25 SMART
FAS1 334 440 6.92e-22 SMART
EGF 515 555 1.95e1 SMART
EGF_like 526 566 2.46e-1 SMART
EGF 565 599 1.14e0 SMART
EGF 607 638 1.56e1 SMART
EGF 643 680 1.36e1 SMART
EGF 684 723 2.13e0 SMART
LINK 754 848 2.08e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219341
Meta Mutation Damage Score 0.9468 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,928,195 (GRCm39) N512T possibly damaging Het
Aadacl2 A T 3: 59,932,313 (GRCm39) H276L probably damaging Het
Adam12 G A 7: 133,533,543 (GRCm39) T445M probably benign Het
Ash2l A T 8: 26,317,406 (GRCm39) F290L probably benign Het
Asxl3 C T 18: 22,658,281 (GRCm39) P2097L probably benign Het
Atmin A G 8: 117,684,115 (GRCm39) I592V probably damaging Het
Atxn2 T C 5: 121,941,145 (GRCm39) probably null Het
BC004004 T C 17: 29,515,665 (GRCm39) probably null Het
Cacna1e T C 1: 154,437,552 (GRCm39) N328S possibly damaging Het
Cacna2d1 A T 5: 16,560,493 (GRCm39) K765I probably damaging Het
Cc2d1a A G 8: 84,860,604 (GRCm39) probably null Het
Ccdc28b A G 4: 129,514,408 (GRCm39) V198A probably benign Het
Ces1b G T 8: 93,794,736 (GRCm39) R288S probably damaging Het
Cfap100 T G 6: 90,389,166 (GRCm39) T198P probably benign Het
Clint1 T C 11: 45,781,610 (GRCm39) S227P probably damaging Het
Cntn5 C A 9: 10,145,344 (GRCm39) C122F probably damaging Het
Col3a1 A G 1: 45,382,472 (GRCm39) probably null Het
Cyp4a10 A C 4: 115,386,646 (GRCm39) D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,769,708 (GRCm39) probably null Het
Dlc1 A T 8: 37,060,617 (GRCm39) probably benign Het
Dlgap2 T C 8: 14,777,060 (GRCm39) S102P probably benign Het
Dnah7b G A 1: 46,117,753 (GRCm39) probably benign Het
Dock10 A C 1: 80,526,853 (GRCm39) S1124A probably benign Het
Dscam C T 16: 96,621,151 (GRCm39) R519H probably damaging Het
Efcab3 A T 11: 104,999,581 (GRCm39) probably benign Het
Evi2a G T 11: 79,418,096 (GRCm39) N171K probably damaging Het
Fbxl15 T C 19: 46,318,684 (GRCm39) L286P probably damaging Het
Fpr1 T A 17: 18,097,525 (GRCm39) I155F probably benign Het
Gcat C T 15: 78,918,194 (GRCm39) A84V probably null Het
Gls A G 1: 52,230,293 (GRCm39) F473L possibly damaging Het
Gnat1 T C 9: 107,554,164 (GRCm39) D169G probably damaging Het
Grm3 A C 5: 9,639,958 (GRCm39) M29R probably benign Het
Herc1 A T 9: 66,375,085 (GRCm39) D3303V probably damaging Het
Ibsp G A 5: 104,458,405 (GRCm39) G314D unknown Het
Irag2 C T 6: 145,120,237 (GRCm39) T484M possibly damaging Het
Lgr6 C A 1: 134,915,210 (GRCm39) A513S probably damaging Het
Lrriq4 T A 3: 30,704,910 (GRCm39) C313S probably damaging Het
Marchf10 G T 11: 105,281,409 (GRCm39) T292K probably damaging Het
Mcoln2 C A 3: 145,896,137 (GRCm39) Y6* probably null Het
Mup4 A G 4: 59,958,076 (GRCm39) I164T probably damaging Het
Myo1b T C 1: 51,817,717 (GRCm39) probably benign Het
Ncam1 A G 9: 49,456,100 (GRCm39) I506T probably damaging Het
Notch1 A T 2: 26,370,976 (GRCm39) probably benign Het
Nr4a3 A T 4: 48,051,777 (GRCm39) Q177L probably benign Het
Nsun4 A G 4: 115,910,147 (GRCm39) S138P possibly damaging Het
Or1a1 A G 11: 74,086,505 (GRCm39) M59V probably damaging Het
Or2b6 G T 13: 21,823,560 (GRCm39) N44K probably benign Het
Or2d36 A T 7: 106,747,405 (GRCm39) N294I probably damaging Het
Or4k5 T C 14: 50,385,815 (GRCm39) N172S probably damaging Het
Pagr1a A T 7: 126,615,469 (GRCm39) probably benign Het
Pcdhb2 A T 18: 37,429,343 (GRCm39) I82L probably benign Het
Pds5b A T 5: 150,677,882 (GRCm39) N500I probably damaging Het
Pik3r6 A T 11: 68,422,271 (GRCm39) E223D possibly damaging Het
Pkhd1l1 A T 15: 44,404,384 (GRCm39) probably benign Het
Prex1 T C 2: 166,422,383 (GRCm39) D1204G probably damaging Het
Prickle1 C T 15: 93,402,955 (GRCm39) E244K possibly damaging Het
Ptprd A T 4: 76,002,789 (GRCm39) V211E probably damaging Het
Rad51d G A 11: 82,781,179 (GRCm39) R23* probably null Het
Rapgef6 G A 11: 54,517,534 (GRCm39) G262R probably damaging Het
Reln A G 5: 22,333,600 (GRCm39) probably benign Het
Rev1 T C 1: 38,127,286 (GRCm39) T325A probably damaging Het
Rnd3 T A 2: 51,022,518 (GRCm39) I175L probably benign Het
Rp1 C A 1: 4,417,619 (GRCm39) L1164F probably damaging Het
S100a7a T C 3: 90,562,942 (GRCm39) V43A probably benign Het
Scaper A C 9: 55,510,202 (GRCm39) Y1104* probably null Het
Scn2a T A 2: 65,594,938 (GRCm39) V1929D probably benign Het
Scn3a T C 2: 65,359,785 (GRCm39) N141S possibly damaging Het
Slc12a7 T G 13: 73,949,127 (GRCm39) L718R probably damaging Het
Slc15a2 T C 16: 36,605,005 (GRCm39) probably benign Het
Slc35b3 G A 13: 39,138,110 (GRCm39) Q100* probably null Het
Slc9a5 T A 8: 106,081,785 (GRCm39) V170E possibly damaging Het
Snx5 T G 2: 144,096,731 (GRCm39) K278T possibly damaging Het
Sorbs2 T C 8: 46,243,000 (GRCm39) probably benign Het
Stab1 C T 14: 30,873,647 (GRCm39) W1008* probably null Het
Tacc3 A G 5: 33,825,321 (GRCm39) E377G probably benign Het
Tango6 T C 8: 107,415,671 (GRCm39) L164P probably damaging Het
Tbc1d12 T A 19: 38,902,796 (GRCm39) S570T possibly damaging Het
Thbs1 T C 2: 117,944,836 (GRCm39) F217L probably damaging Het
Tmbim6 T A 15: 99,300,004 (GRCm39) V40E probably damaging Het
Tmigd1 A T 11: 76,800,986 (GRCm39) N158Y probably damaging Het
Top3b C T 16: 16,710,641 (GRCm39) R824* probably null Het
Tram1l1 A T 3: 124,115,580 (GRCm39) K247* probably null Het
Tsc2 T C 17: 24,833,366 (GRCm39) Y686C probably damaging Het
Tsga10 T C 1: 37,858,680 (GRCm39) Q218R probably damaging Het
Uba6 G T 5: 86,288,282 (GRCm39) A439D probably damaging Het
Ubn1 C A 16: 4,895,158 (GRCm39) P735T probably damaging Het
Usp40 A G 1: 87,909,808 (GRCm39) S549P probably benign Het
Utp20 T C 10: 88,655,201 (GRCm39) T176A probably benign Het
Utp4 T G 8: 107,624,685 (GRCm39) probably benign Het
Xpo5 C T 17: 46,518,853 (GRCm39) probably benign Het
Zfp979 A T 4: 147,698,493 (GRCm39) I72K possibly damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTCCCTATACCCCGCTAACC -3'
(R):5'- ATGGCCCTGTCGAGGTAGAATCAG -3'

Sequencing Primer
(F):5'- gcatctcctctcaccttagtttc -3'
(R):5'- AACAACCGGGGCATGTGTTA -3'
Posted On 2014-03-14