Incidental Mutation 'R1440:Rapgef6'
ID 160948
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 039495-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1440 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54517534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 262 (G262R)
Ref Sequence ENSEMBL: ENSMUSP00000151509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
AlphaFold Q5NCJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000094536
AA Change: G124R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: G124R

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: G409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: G409R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: G409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: G409R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108894
AA Change: G124R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: G124R

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108895
AA Change: G409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: G409R

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149372
Predicted Effect probably damaging
Transcript: ENSMUST00000207429
AA Change: G409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218995
AA Change: G262R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220269
Meta Mutation Damage Score 0.3941 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,928,195 (GRCm39) N512T possibly damaging Het
Aadacl2 A T 3: 59,932,313 (GRCm39) H276L probably damaging Het
Adam12 G A 7: 133,533,543 (GRCm39) T445M probably benign Het
Ash2l A T 8: 26,317,406 (GRCm39) F290L probably benign Het
Asxl3 C T 18: 22,658,281 (GRCm39) P2097L probably benign Het
Atmin A G 8: 117,684,115 (GRCm39) I592V probably damaging Het
Atxn2 T C 5: 121,941,145 (GRCm39) probably null Het
BC004004 T C 17: 29,515,665 (GRCm39) probably null Het
Cacna1e T C 1: 154,437,552 (GRCm39) N328S possibly damaging Het
Cacna2d1 A T 5: 16,560,493 (GRCm39) K765I probably damaging Het
Cc2d1a A G 8: 84,860,604 (GRCm39) probably null Het
Ccdc28b A G 4: 129,514,408 (GRCm39) V198A probably benign Het
Ces1b G T 8: 93,794,736 (GRCm39) R288S probably damaging Het
Cfap100 T G 6: 90,389,166 (GRCm39) T198P probably benign Het
Clint1 T C 11: 45,781,610 (GRCm39) S227P probably damaging Het
Cntn5 C A 9: 10,145,344 (GRCm39) C122F probably damaging Het
Col3a1 A G 1: 45,382,472 (GRCm39) probably null Het
Cyp4a10 A C 4: 115,386,646 (GRCm39) D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,769,708 (GRCm39) probably null Het
Dlc1 A T 8: 37,060,617 (GRCm39) probably benign Het
Dlgap2 T C 8: 14,777,060 (GRCm39) S102P probably benign Het
Dnah7b G A 1: 46,117,753 (GRCm39) probably benign Het
Dock10 A C 1: 80,526,853 (GRCm39) S1124A probably benign Het
Dscam C T 16: 96,621,151 (GRCm39) R519H probably damaging Het
Efcab3 A T 11: 104,999,581 (GRCm39) probably benign Het
Evi2a G T 11: 79,418,096 (GRCm39) N171K probably damaging Het
Fbxl15 T C 19: 46,318,684 (GRCm39) L286P probably damaging Het
Fpr1 T A 17: 18,097,525 (GRCm39) I155F probably benign Het
Gcat C T 15: 78,918,194 (GRCm39) A84V probably null Het
Gls A G 1: 52,230,293 (GRCm39) F473L possibly damaging Het
Gnat1 T C 9: 107,554,164 (GRCm39) D169G probably damaging Het
Grm3 A C 5: 9,639,958 (GRCm39) M29R probably benign Het
Herc1 A T 9: 66,375,085 (GRCm39) D3303V probably damaging Het
Ibsp G A 5: 104,458,405 (GRCm39) G314D unknown Het
Irag2 C T 6: 145,120,237 (GRCm39) T484M possibly damaging Het
Lgr6 C A 1: 134,915,210 (GRCm39) A513S probably damaging Het
Lrriq4 T A 3: 30,704,910 (GRCm39) C313S probably damaging Het
Marchf10 G T 11: 105,281,409 (GRCm39) T292K probably damaging Het
Mcoln2 C A 3: 145,896,137 (GRCm39) Y6* probably null Het
Mup4 A G 4: 59,958,076 (GRCm39) I164T probably damaging Het
Myo1b T C 1: 51,817,717 (GRCm39) probably benign Het
Ncam1 A G 9: 49,456,100 (GRCm39) I506T probably damaging Het
Notch1 A T 2: 26,370,976 (GRCm39) probably benign Het
Nr4a3 A T 4: 48,051,777 (GRCm39) Q177L probably benign Het
Nsun4 A G 4: 115,910,147 (GRCm39) S138P possibly damaging Het
Or1a1 A G 11: 74,086,505 (GRCm39) M59V probably damaging Het
Or2b6 G T 13: 21,823,560 (GRCm39) N44K probably benign Het
Or2d36 A T 7: 106,747,405 (GRCm39) N294I probably damaging Het
Or4k5 T C 14: 50,385,815 (GRCm39) N172S probably damaging Het
Pagr1a A T 7: 126,615,469 (GRCm39) probably benign Het
Pcdhb2 A T 18: 37,429,343 (GRCm39) I82L probably benign Het
Pds5b A T 5: 150,677,882 (GRCm39) N500I probably damaging Het
Pik3r6 A T 11: 68,422,271 (GRCm39) E223D possibly damaging Het
Pkhd1l1 A T 15: 44,404,384 (GRCm39) probably benign Het
Prex1 T C 2: 166,422,383 (GRCm39) D1204G probably damaging Het
Prickle1 C T 15: 93,402,955 (GRCm39) E244K possibly damaging Het
Ptprd A T 4: 76,002,789 (GRCm39) V211E probably damaging Het
Rad51d G A 11: 82,781,179 (GRCm39) R23* probably null Het
Reln A G 5: 22,333,600 (GRCm39) probably benign Het
Rev1 T C 1: 38,127,286 (GRCm39) T325A probably damaging Het
Rnd3 T A 2: 51,022,518 (GRCm39) I175L probably benign Het
Rp1 C A 1: 4,417,619 (GRCm39) L1164F probably damaging Het
S100a7a T C 3: 90,562,942 (GRCm39) V43A probably benign Het
Scaper A C 9: 55,510,202 (GRCm39) Y1104* probably null Het
Scn2a T A 2: 65,594,938 (GRCm39) V1929D probably benign Het
Scn3a T C 2: 65,359,785 (GRCm39) N141S possibly damaging Het
Slc12a7 T G 13: 73,949,127 (GRCm39) L718R probably damaging Het
Slc15a2 T C 16: 36,605,005 (GRCm39) probably benign Het
Slc35b3 G A 13: 39,138,110 (GRCm39) Q100* probably null Het
Slc9a5 T A 8: 106,081,785 (GRCm39) V170E possibly damaging Het
Snx5 T G 2: 144,096,731 (GRCm39) K278T possibly damaging Het
Sorbs2 T C 8: 46,243,000 (GRCm39) probably benign Het
Stab1 C T 14: 30,873,647 (GRCm39) W1008* probably null Het
Stab2 C T 10: 86,697,231 (GRCm39) probably null Het
Tacc3 A G 5: 33,825,321 (GRCm39) E377G probably benign Het
Tango6 T C 8: 107,415,671 (GRCm39) L164P probably damaging Het
Tbc1d12 T A 19: 38,902,796 (GRCm39) S570T possibly damaging Het
Thbs1 T C 2: 117,944,836 (GRCm39) F217L probably damaging Het
Tmbim6 T A 15: 99,300,004 (GRCm39) V40E probably damaging Het
Tmigd1 A T 11: 76,800,986 (GRCm39) N158Y probably damaging Het
Top3b C T 16: 16,710,641 (GRCm39) R824* probably null Het
Tram1l1 A T 3: 124,115,580 (GRCm39) K247* probably null Het
Tsc2 T C 17: 24,833,366 (GRCm39) Y686C probably damaging Het
Tsga10 T C 1: 37,858,680 (GRCm39) Q218R probably damaging Het
Uba6 G T 5: 86,288,282 (GRCm39) A439D probably damaging Het
Ubn1 C A 16: 4,895,158 (GRCm39) P735T probably damaging Het
Usp40 A G 1: 87,909,808 (GRCm39) S549P probably benign Het
Utp20 T C 10: 88,655,201 (GRCm39) T176A probably benign Het
Utp4 T G 8: 107,624,685 (GRCm39) probably benign Het
Xpo5 C T 17: 46,518,853 (GRCm39) probably benign Het
Zfp979 A T 4: 147,698,493 (GRCm39) I72K possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGCTTATGCCGCTTGATTTCTTGC -3'
(R):5'- CACCTTCACTGTGGACTCTGTGTG -3'

Sequencing Primer
(F):5'- GCTCTGCCTTGGTGCATAG -3'
(R):5'- GGCAATAATTACCCCTTATCATTCAG -3'
Posted On 2014-03-14