Incidental Mutation 'R1440:March10'
ID160955
Institutional Source Beutler Lab
Gene Symbol March10
Ensembl Gene ENSMUSG00000078627
Gene Namemembrane-associated ring finger (C3HC4) 10
Synonyms4933417C16Rik, OTTMUSG00000002847, Rnf190
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105360798-105456735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105390583 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 292 (T292K)
Ref Sequence ENSEMBL: ENSMUSP00000121919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049995] [ENSMUST00000138977]
Predicted Effect probably damaging
Transcript: ENSMUST00000049995
AA Change: T292K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063198
Gene: ENSMUSG00000078627
AA Change: T292K

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138977
AA Change: T292K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121919
Gene: ENSMUSG00000078627
AA Change: T292K

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153672
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in March10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:March10 APN 11 105402188 missense possibly damaging 0.82
IGL01461:March10 APN 11 105389605 missense probably damaging 1.00
IGL01473:March10 APN 11 105389605 missense probably damaging 1.00
Forward UTSW 11 105382237 missense probably damaging 1.00
PIT4142001:March10 UTSW 11 105390520 missense probably benign 0.17
R0195:March10 UTSW 11 105385525 missense probably damaging 1.00
R0520:March10 UTSW 11 105389882 missense probably benign
R0628:March10 UTSW 11 105390160 missense probably benign 0.00
R1087:March10 UTSW 11 105390662 missense probably damaging 1.00
R1802:March10 UTSW 11 105389915 missense probably benign 0.00
R1855:March10 UTSW 11 105390392 missense probably benign
R1860:March10 UTSW 11 105397078 missense probably damaging 0.99
R2504:March10 UTSW 11 105385572 missense probably damaging 1.00
R3788:March10 UTSW 11 105397079 missense probably damaging 1.00
R4629:March10 UTSW 11 105389838 missense probably benign 0.28
R4755:March10 UTSW 11 105364476 intron probably benign
R4776:March10 UTSW 11 105390037 missense probably benign 0.42
R5067:March10 UTSW 11 105390107 missense possibly damaging 0.51
R5192:March10 UTSW 11 105371926 missense possibly damaging 0.68
R5436:March10 UTSW 11 105402165 missense possibly damaging 0.92
R5541:March10 UTSW 11 105390131 missense probably damaging 1.00
R5888:March10 UTSW 11 105402146 missense possibly damaging 0.92
R5908:March10 UTSW 11 105390239 missense probably benign 0.00
R5914:March10 UTSW 11 105385482 missense probably damaging 1.00
R6038:March10 UTSW 11 105402051 missense probably damaging 0.96
R6178:March10 UTSW 11 105389614 missense probably damaging 1.00
R6300:March10 UTSW 11 105382237 missense probably damaging 1.00
R6612:March10 UTSW 11 105397078 missense probably damaging 0.99
R6894:March10 UTSW 11 105396961 missense possibly damaging 0.94
R6921:March10 UTSW 11 105389777 missense probably benign 0.00
R7134:March10 UTSW 11 105408676 missense probably benign
R7199:March10 UTSW 11 105390706 missense probably damaging 0.99
R7546:March10 UTSW 11 105390080 missense not run
Z1088:March10 UTSW 11 105390359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATCTTGGAGCATCCTTTGCCC -3'
(R):5'- TGTCCAACAAGAAAGCCTGCTGTG -3'

Sequencing Primer
(F):5'- CATCCTTTGCCCAGGAGAAG -3'
(R):5'- CCTGCTGTGTGCAAATGAGAC -3'
Posted On2014-03-14