Incidental Mutation 'R1440:Dscam'
ID160969
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 039495-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96819951 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 519 (R519H)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect probably damaging
Transcript: ENSMUST00000056102
AA Change: R519H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: R519H

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGTACCAGCACATTACACG -3'
(R):5'- AGCCGCATAACCTGCATCTTCATC -3'

Sequencing Primer
(F):5'- GTGTACTCTCCCTCGTCAAC -3'
(R):5'- CAGAGTCAATCAGTTACTCTTAGCC -3'
Posted On2014-03-14