Incidental Mutation 'R1440:Pcdhb2'
ID160977
Institutional Source Beutler Lab
Gene Symbol Pcdhb2
Ensembl Gene ENSMUSG00000051599
Gene Nameprotocadherin beta 2
SynonymsPcdhbB
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37294812-37297624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37296290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 82 (I82L)
Ref Sequence ENSEMBL: ENSMUSP00000141439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
AA Change: I439L

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599
AA Change: I439L

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
AA Change: I82L

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599
AA Change: I82L

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1741 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Sorbs2 T C 8: 45,789,963 probably benign Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Pcdhb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Pcdhb2 APN 18 37296463 unclassified probably null
IGL01538:Pcdhb2 APN 18 37295322 nonsense probably null
IGL01716:Pcdhb2 APN 18 37296738 missense probably damaging 0.99
IGL01747:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01770:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01999:Pcdhb2 APN 18 37296837 missense probably damaging 1.00
IGL02174:Pcdhb2 APN 18 37296498 missense probably damaging 1.00
IGL02325:Pcdhb2 APN 18 37296680 missense possibly damaging 0.91
IGL03148:Pcdhb2 APN 18 37296778 missense probably damaging 1.00
IGL03263:Pcdhb2 APN 18 37296006 missense probably damaging 1.00
R0158:Pcdhb2 UTSW 18 37297230 missense probably damaging 1.00
R0512:Pcdhb2 UTSW 18 37295979 missense probably damaging 1.00
R0656:Pcdhb2 UTSW 18 37295490 missense probably damaging 1.00
R0670:Pcdhb2 UTSW 18 37296648 missense probably damaging 1.00
R0698:Pcdhb2 UTSW 18 37297366 missense probably benign 0.00
R0825:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0827:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0862:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0863:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1344:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1826:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1828:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1869:Pcdhb2 UTSW 18 37297355 unclassified probably null
R1871:Pcdhb2 UTSW 18 37297355 unclassified probably null
R2292:Pcdhb2 UTSW 18 37297244 unclassified probably null
R3743:Pcdhb2 UTSW 18 37296417 missense probably damaging 1.00
R4067:Pcdhb2 UTSW 18 37297314 unclassified probably null
R4127:Pcdhb2 UTSW 18 37295541 missense probably damaging 0.97
R4402:Pcdhb2 UTSW 18 37295402 missense probably benign 0.05
R4579:Pcdhb2 UTSW 18 37296115 missense probably damaging 1.00
R4621:Pcdhb2 UTSW 18 37295927 missense probably benign 0.44
R4678:Pcdhb2 UTSW 18 37296207 missense probably damaging 1.00
R5143:Pcdhb2 UTSW 18 37296732 missense probably damaging 1.00
R5152:Pcdhb2 UTSW 18 37296126 missense probably damaging 0.97
R6552:Pcdhb2 UTSW 18 37295993 missense probably benign
R6908:Pcdhb2 UTSW 18 37296524 missense probably damaging 1.00
R6973:Pcdhb2 UTSW 18 37296363 missense probably benign 0.03
R7143:Pcdhb2 UTSW 18 37295881 missense probably benign 0.05
R7248:Pcdhb2 UTSW 18 37296494 missense probably damaging 1.00
R7586:Pcdhb2 UTSW 18 37295804 nonsense probably null
R7634:Pcdhb2 UTSW 18 37294947 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTTCCCAAGCCTCTGAAGAC -3'
(R):5'- GATGTGGGCATTAGAGCCTGAGTC -3'

Sequencing Primer
(F):5'- GGATTTTGAATCCATCCAGGC -3'
(R):5'- GCATTAGAGCCTGAGTCTGAATC -3'
Posted On2014-03-14