Incidental Mutation 'R1441:Card9'
ID160983
Institutional Source Beutler Lab
Gene Symbol Card9
Ensembl Gene ENSMUSG00000026928
Gene Namecaspase recruitment domain family, member 9
SynonymsLOC332579
MMRRC Submission 039496-MU
Accession Numbers

Ncbi RefSeq: NM_001037747; MGI:2685628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1441 (G1)
Quality Score216
Status Not validated
Chromosome2
Chromosomal Location26352176-26360918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26359390 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 53 (N53S)
Ref Sequence ENSEMBL: ENSMUSP00000097876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000035427] [ENSMUST00000100303] [ENSMUST00000114115]
Predicted Effect probably benign
Transcript: ENSMUST00000028294
AA Change: N53S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: N53S

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100303
AA Change: N53S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: N53S

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149850
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Card9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Card9 APN 2 26356862 missense probably benign
IGL02397:Card9 APN 2 26352329 missense probably damaging 1.00
IGL02506:Card9 APN 2 26354415 splice site probably benign
IGL02536:Card9 APN 2 26358832 missense possibly damaging 0.93
IGL02809:Card9 APN 2 26356864 missense probably benign 0.01
IGL02962:Card9 APN 2 26358017 critical splice acceptor site probably null
R1585:Card9 UTSW 2 26354386 missense probably benign 0.01
R1755:Card9 UTSW 2 26359534 missense probably damaging 0.99
R1959:Card9 UTSW 2 26354873 critical splice acceptor site probably null
R2972:Card9 UTSW 2 26357210 missense probably damaging 1.00
R4007:Card9 UTSW 2 26353000 missense possibly damaging 0.95
R4283:Card9 UTSW 2 26357297 missense possibly damaging 0.77
R4789:Card9 UTSW 2 26357620 missense probably damaging 0.99
R5381:Card9 UTSW 2 26358883 missense probably damaging 1.00
R5933:Card9 UTSW 2 26352497 missense probably damaging 1.00
R6379:Card9 UTSW 2 26356777 missense probably damaging 1.00
R7008:Card9 UTSW 2 26357799 missense possibly damaging 0.96
R7124:Card9 UTSW 2 26356884 critical splice acceptor site probably null
R7131:Card9 UTSW 2 26358835 missense probably damaging 1.00
R7171:Card9 UTSW 2 26359484 missense possibly damaging 0.78
R7237:Card9 UTSW 2 26356775 missense probably benign 0.00
R7984:Card9 UTSW 2 26356772 missense probably benign 0.00
R8023:Card9 UTSW 2 26357315 missense probably benign 0.00
R8312:Card9 UTSW 2 26357789 nonsense probably null
Z1176:Card9 UTSW 2 26357796 missense probably damaging 1.00
Z1177:Card9 UTSW 2 26357551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATCCTACACGGGGATGGAGCTG -3'
(R):5'- CAGAAACTGTCCATGAGGCTGAGG -3'

Sequencing Primer
(F):5'- CTGAGTGGGGACAAGGC -3'
(R):5'- AAGGTGGGCACTTCCTCAG -3'
Posted On2014-03-14