Incidental Mutation 'R1441:Rpusd4'
ID161015
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35272769 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 240 (A240E)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564]
Predicted Effect probably damaging
Transcript: ENSMUST00000034543
AA Change: A240E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: A240E

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130552
Predicted Effect probably benign
Transcript: ENSMUST00000144582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147256
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Arsk A T 13: 76,074,964 N171K probably benign Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1081:Rpusd4 UTSW 9 35275088 missense probably benign 0.04
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R3929:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7819:Rpusd4 UTSW 9 35267932 missense probably benign
R7995:Rpusd4 UTSW 9 35272721 missense probably damaging 0.99
R8227:Rpusd4 UTSW 9 35268535 missense probably benign 0.22
R8246:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
V1662:Rpusd4 UTSW 9 35272761 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAAACAGCAGTCTGTGTGTCACC -3'
(R):5'- TCCCTCCTGGGCTAAGTCAATTATACC -3'

Sequencing Primer
(F):5'- ATCACGGTGCGTGTTCC -3'
(R):5'- TGGGCTAAGTCAATTATACCCACAC -3'
Posted On2014-03-14