Incidental Mutation 'R1441:Arsk'
ID161027
Institutional Source Beutler Lab
Gene Symbol Arsk
Ensembl Gene ENSMUSG00000021592
Gene Namearylsulfatase K
Synonyms
MMRRC Submission 039496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1441 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location76060422-76098660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76074964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 171 (N171K)
Ref Sequence ENSEMBL: ENSMUSP00000113274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120573] [ENSMUST00000223579]
Predicted Effect probably benign
Transcript: ENSMUST00000120573
AA Change: N171K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113274
Gene: ENSMUSG00000021592
AA Change: N171K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sulfatase 35 371 6e-49 PFAM
low complexity region 381 392 N/A INTRINSIC
low complexity region 537 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146753
Predicted Effect probably benign
Transcript: ENSMUST00000223579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225642
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 113,754,562 probably null Het
Ankrd16 T C 2: 11,778,746 L53P probably damaging Het
Brwd1 A C 16: 96,066,151 C161W probably damaging Het
Card9 T C 2: 26,359,390 N53S probably benign Het
Ccdc13 A T 9: 121,813,449 V403E probably benign Het
Ccdc83 T A 7: 90,244,143 E135D probably damaging Het
Ccser1 C T 6: 62,380,032 T818I probably benign Het
Cd44 T A 2: 102,846,418 T301S probably damaging Het
Eepd1 G A 9: 25,483,203 M254I probably benign Het
Ephb4 C T 5: 137,361,247 R360C probably damaging Het
Fam149a G T 8: 45,355,647 Q150K probably damaging Het
Fam208a T A 14: 27,464,260 C805* probably null Het
G6pc2 G A 2: 69,220,854 C97Y probably damaging Het
Gcsam T A 16: 45,613,038 M15K probably benign Het
Impdh2 C A 9: 108,564,776 T201K probably benign Het
Kdm2b C T 5: 122,932,880 E379K probably benign Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Mink1 T A 11: 70,607,114 N514K possibly damaging Het
Mmp12 C T 9: 7,354,787 P330L probably damaging Het
Mroh2a A G 1: 88,241,631 D676G possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Naip5 T C 13: 100,219,717 H1130R possibly damaging Het
Ninl C A 2: 150,971,124 G204V probably benign Het
Olfr1301 T C 2: 111,755,002 F251S probably damaging Het
Olfr202 G A 16: 59,283,865 L211F probably benign Het
Olfr235 T A 19: 12,268,386 L52* probably null Het
Olfr358 C A 2: 37,005,119 R165L possibly damaging Het
Olfr441 T C 6: 43,115,946 V68A probably benign Het
Olfr893 T C 9: 38,209,481 C141R probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Ptpn22 G T 3: 103,874,247 W114L probably damaging Het
Rasa1 C T 13: 85,252,421 probably null Het
Rbks C T 5: 31,659,997 V143I probably benign Het
Rbm19 T C 5: 120,131,176 F515L probably damaging Het
Ror1 A G 4: 100,440,983 T518A probably benign Het
Rpusd4 C A 9: 35,272,769 A240E probably damaging Het
Rufy3 T C 5: 88,632,515 L374P probably damaging Het
Sf3a3 T C 4: 124,725,142 S299P probably damaging Het
Slc7a12 T G 3: 14,497,354 S264A possibly damaging Het
Tm9sf1 T C 14: 55,636,325 Y572C probably damaging Het
Tmem55a A T 4: 14,892,477 I114L possibly damaging Het
Tpcn2 G A 7: 145,260,134 S475L probably benign Het
Trim17 A G 11: 58,965,192 D25G probably damaging Het
Ttn T A 2: 76,741,777 K26257N probably damaging Het
Txndc11 C A 16: 11,134,550 probably benign Het
Utrn A G 10: 12,683,295 S1405P probably damaging Het
Vmn2r58 G A 7: 41,837,440 T677I probably damaging Het
Other mutations in Arsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Arsk APN 13 76098368 splice site probably null
IGL02537:Arsk APN 13 76074906 nonsense probably null
IGL02691:Arsk APN 13 76074950 missense probably damaging 0.98
IGL03038:Arsk APN 13 76065513 splice site probably benign
PIT4480001:Arsk UTSW 13 76062365 missense probably damaging 1.00
R0277:Arsk UTSW 13 76074932 missense probably benign 0.01
R0900:Arsk UTSW 13 76098457 unclassified probably benign
R1748:Arsk UTSW 13 76062410 missense probably benign 0.15
R1923:Arsk UTSW 13 76066866 splice site probably benign
R2131:Arsk UTSW 13 76091812 nonsense probably null
R3723:Arsk UTSW 13 76066653 missense probably damaging 0.98
R4088:Arsk UTSW 13 76098414 missense probably benign
R4851:Arsk UTSW 13 76065279 critical splice donor site probably null
R5406:Arsk UTSW 13 76093947 missense probably benign
R5629:Arsk UTSW 13 76093908 missense probably damaging 1.00
R5869:Arsk UTSW 13 76091784 missense probably benign 0.29
R6217:Arsk UTSW 13 76091816 missense unknown
R6552:Arsk UTSW 13 76072196 missense probably damaging 0.99
R6560:Arsk UTSW 13 76074986 missense probably benign 0.33
R6726:Arsk UTSW 13 76074788 missense probably damaging 1.00
R7421:Arsk UTSW 13 76062515 missense possibly damaging 0.81
R8178:Arsk UTSW 13 76091742 missense probably damaging 1.00
R8274:Arsk UTSW 13 76072184 missense probably damaging 1.00
X0050:Arsk UTSW 13 76065280 missense probably null 0.78
X0066:Arsk UTSW 13 76062456 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGTGTCTGCTTTTGAGCACACATAG -3'
(R):5'- GAGTGTTAAAACCATTTCCCCTGTTGC -3'

Sequencing Primer
(F):5'- CTGCTTTTGAGCACACATAGAATAC -3'
(R):5'- CCTGTTGCTTTCCAGCATTTG -3'
Posted On2014-03-14