Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Prrc2b'

161045

Institutional Source

Beutler Lab

Gene Symbol

Prrc2b

Ensembl Gene

ENSMUSG00000039262

Gene Name

proline-rich coiled-coil 2B

Synonyms

5830434P21Rik, Bat2l

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32151082-32234537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32194985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 296 (D296V)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]

AlphaFold

Q7TPM1

Predicted Effect

probably damaging
Transcript: ENSMUST00000036691
AA Change: D369V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262
AA Change: D369V

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	194	2.7e-85	PFAM
low complexity region	359	374	N/A	INTRINSIC
low complexity region	388	394	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
coiled coil region	494	544	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	638	656	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1218	1233	N/A	INTRINSIC
low complexity region	1257	1275	N/A	INTRINSIC
low complexity region	1402	1421	N/A	INTRINSIC
low complexity region	1425	1437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069817
AA Change: D369V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: D369V

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	191	3.1e-65	PFAM
low complexity region	359	374	N/A	INTRINSIC
low complexity region	388	394	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
coiled coil region	494	544	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	638	656	N/A	INTRINSIC
low complexity region	960	977	N/A	INTRINSIC
low complexity region	1004	1018	N/A	INTRINSIC
low complexity region	1070	1094	N/A	INTRINSIC
low complexity region	1307	1325	N/A	INTRINSIC
low complexity region	1388	1401	N/A	INTRINSIC
low complexity region	1413	1426	N/A	INTRINSIC
low complexity region	1572	1587	N/A	INTRINSIC
low complexity region	1678	1693	N/A	INTRINSIC
low complexity region	1798	1812	N/A	INTRINSIC
low complexity region	1904	1919	N/A	INTRINSIC
low complexity region	1943	1961	N/A	INTRINSIC
low complexity region	2088	2107	N/A	INTRINSIC
low complexity region	2111	2123	N/A	INTRINSIC
low complexity region	2161	2174	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132459
AA Change: D296V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262
AA Change: D296V

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	119	9.8e-24	PFAM
low complexity region	287	302	N/A	INTRINSIC
low complexity region	316	322	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
coiled coil region	421	471	N/A	INTRINSIC
low complexity region	528	549	N/A	INTRINSIC
low complexity region	566	584	N/A	INTRINSIC
low complexity region	813	828	N/A	INTRINSIC
low complexity region	920	935	N/A	INTRINSIC
low complexity region	1040	1054	N/A	INTRINSIC
low complexity region	1146	1161	N/A	INTRINSIC
low complexity region	1185	1203	N/A	INTRINSIC
low complexity region	1330	1349	N/A	INTRINSIC
low complexity region	1353	1365	N/A	INTRINSIC
low complexity region	1403	1416	N/A	INTRINSIC

Meta Mutation Damage Score

0.8687

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Prrc2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Prrc2b	APN	2	32208719	missense	probably damaging	1.00
IGL00846:Prrc2b	APN	2	32199097	splice site	probably benign
IGL00977:Prrc2b	APN	2	32213810	missense	probably benign	0.05
IGL01372:Prrc2b	APN	2	32223930	missense	probably damaging	0.99
IGL01993:Prrc2b	APN	2	32224045	missense	possibly damaging	0.47
IGL02097:Prrc2b	APN	2	32191501	splice site	probably benign
IGL02165:Prrc2b	APN	2	32214640	missense	probably damaging	1.00
IGL02184:Prrc2b	APN	2	32221455	missense	probably benign	0.19
IGL02238:Prrc2b	APN	2	32213417	missense	probably damaging	1.00
IGL02338:Prrc2b	APN	2	32214035	missense	probably benign	0.01
IGL02399:Prrc2b	APN	2	32226961	nonsense	probably null
IGL02597:Prrc2b	APN	2	32219613	missense	probably damaging	1.00
IGL02729:Prrc2b	APN	2	32208758	missense	probably damaging	0.99
IGL02743:Prrc2b	APN	2	32194429	missense	probably damaging	1.00
IGL02815:Prrc2b	APN	2	32204253	missense	probably damaging	1.00
IGL03159:Prrc2b	APN	2	32194486	missense	probably damaging	0.98
BB002:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
BB012:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
FR4304:Prrc2b	UTSW	2	32221167	missense	probably damaging	1.00
R0082:Prrc2b	UTSW	2	32212298	splice site	probably benign
R0105:Prrc2b	UTSW	2	32213311	nonsense	probably null
R0276:Prrc2b	UTSW	2	32219654	missense	probably damaging	0.97
R0325:Prrc2b	UTSW	2	32199091	missense	probably damaging	1.00
R0436:Prrc2b	UTSW	2	32230660	missense	probably damaging	1.00
R0595:Prrc2b	UTSW	2	32183177	missense	probably damaging	1.00
R0607:Prrc2b	UTSW	2	32213870	missense	probably damaging	0.99
R0650:Prrc2b	UTSW	2	32229255	splice site	probably benign
R1282:Prrc2b	UTSW	2	32223444	missense	probably damaging	0.96
R1421:Prrc2b	UTSW	2	32200978	missense	possibly damaging	0.65
R1535:Prrc2b	UTSW	2	32204289	missense	probably benign	0.06
R1709:Prrc2b	UTSW	2	32194461	missense	probably damaging	1.00
R1710:Prrc2b	UTSW	2	32212222	missense	probably damaging	0.99
R2094:Prrc2b	UTSW	2	32182570	missense	probably damaging	1.00
R2202:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2203:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2204:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2428:Prrc2b	UTSW	2	32216055	missense	probably benign	0.00
R2435:Prrc2b	UTSW	2	32219729	missense	probably damaging	0.99
R3439:Prrc2b	UTSW	2	32206347	missense	probably benign	0.01
R4175:Prrc2b	UTSW	2	32218808	intron	probably benign
R4710:Prrc2b	UTSW	2	32193857	missense	possibly damaging	0.80
R4728:Prrc2b	UTSW	2	32230625	missense	probably damaging	1.00
R4791:Prrc2b	UTSW	2	32217339	splice site	probably null
R4876:Prrc2b	UTSW	2	32214200	missense	probably benign	0.00
R4908:Prrc2b	UTSW	2	32226318	missense	possibly damaging	0.94
R4997:Prrc2b	UTSW	2	32222311	missense	probably damaging	1.00
R5240:Prrc2b	UTSW	2	32206396	missense	probably benign	0.01
R5276:Prrc2b	UTSW	2	32214722	missense	probably benign	0.09
R5455:Prrc2b	UTSW	2	32221343	critical splice acceptor site	probably null
R5821:Prrc2b	UTSW	2	32212132	missense	probably damaging	0.99
R5835:Prrc2b	UTSW	2	32206473	missense	probably benign	0.18
R5958:Prrc2b	UTSW	2	32212080	missense	possibly damaging	0.89
R6052:Prrc2b	UTSW	2	32212285	missense	possibly damaging	0.92
R6218:Prrc2b	UTSW	2	32208811	missense	probably damaging	1.00
R6428:Prrc2b	UTSW	2	32226496	splice site	probably null
R6505:Prrc2b	UTSW	2	32222320	missense	probably damaging	1.00
R6812:Prrc2b	UTSW	2	32213141	missense	probably benign	0.30
R6826:Prrc2b	UTSW	2	32222288	critical splice acceptor site	probably null
R6827:Prrc2b	UTSW	2	32200951	missense	probably benign	0.37
R7021:Prrc2b	UTSW	2	32221486	missense	probably damaging	1.00
R7078:Prrc2b	UTSW	2	32213519	missense	probably benign	0.01
R7081:Prrc2b	UTSW	2	32213063	missense	probably benign	0.12
R7101:Prrc2b	UTSW	2	32226993	missense	possibly damaging	0.68
R7215:Prrc2b	UTSW	2	32229297	missense	probably damaging	1.00
R7228:Prrc2b	UTSW	2	32214306	nonsense	probably null
R7566:Prrc2b	UTSW	2	32194390	missense	probably benign	0.02
R7719:Prrc2b	UTSW	2	32217268	nonsense	probably null
R7925:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
R7999:Prrc2b	UTSW	2	32194414	missense	probably damaging	0.96
R8099:Prrc2b	UTSW	2	32208674	missense	probably benign	0.06
R8154:Prrc2b	UTSW	2	32218677	missense	probably benign	0.42
R8252:Prrc2b	UTSW	2	32219380	missense	possibly damaging	0.80
R8379:Prrc2b	UTSW	2	32214654	missense	probably damaging	0.96
R8485:Prrc2b	UTSW	2	32212093	missense	possibly damaging	0.83
R8845:Prrc2b	UTSW	2	32212093	missense	possibly damaging	0.83
R8845:Prrc2b	UTSW	2	32216150	missense	possibly damaging	0.89
R8919:Prrc2b	UTSW	2	32214941	missense	probably benign
R8982:Prrc2b	UTSW	2	32212122	missense	probably damaging	1.00
R9065:Prrc2b	UTSW	2	32219292	missense	probably damaging	0.99
R9127:Prrc2b	UTSW	2	32213752	missense	probably damaging	1.00
R9217:Prrc2b	UTSW	2	32213402	missense	probably damaging	1.00
R9338:Prrc2b	UTSW	2	32208767	missense	probably damaging	1.00
R9344:Prrc2b	UTSW	2	32213588	missense	probably benign	0.28
R9386:Prrc2b	UTSW	2	32214113	missense	probably benign
Z1088:Prrc2b	UTSW	2	32214429	missense	probably benign	0.03
Z1088:Prrc2b	UTSW	2	32216732	missense	probably damaging	1.00
Z1177:Prrc2b	UTSW	2	32226352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTCAGACACCAGAGGTGGAAC -3'
(R):5'- ACTGGGTAAGCACACATTCTAGCAC -3'

Sequencing Primer
(F):5'- GAAAGTGACTGTTTGCACTTACAGG -3'
(R):5'- ACATGTGGGCTGCATCTCAG -3'

Posted On

2014-03-14