Mutagenetix > Incidental Mutation

Incidental Mutation 'R1452:Stil'

161060

Institutional Source

Beutler Lab

Gene Symbol

Stil

Ensembl Gene

ENSMUSG00000028718

Gene Name

Scl/Tal1 interrupting locus

Synonyms

Sil

MMRRC Submission

039507-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115000159-115043196 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115039195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 959 (N959S)

Ref Sequence

ENSEMBL: ENSMUSP00000030490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030490
AA Change: N959S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: N959S

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	426	5.1e-199	PFAM
low complexity region	709	724	N/A	INTRINSIC
low complexity region	1106	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129957

SMART Domains

Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	416	1.5e-180	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141933

SMART Domains

Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	392	6.6e-166	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Stil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01506:Stil	APN	4	115024112	missense	probably benign	0.29
IGL01672:Stil	APN	4	115032789	missense	probably damaging	1.00
IGL02058:Stil	APN	4	115014162	missense	probably benign	0.00
IGL02076:Stil	APN	4	115023637	missense	probably benign	0.03
IGL02104:Stil	APN	4	115041482	missense	probably damaging	1.00
IGL02355:Stil	APN	4	115010111	missense	probably damaging	1.00
IGL02362:Stil	APN	4	115010111	missense	probably damaging	1.00
IGL02612:Stil	APN	4	115023696	missense	possibly damaging	0.80
IGL02695:Stil	APN	4	115016175	missense	probably damaging	1.00
IGL02696:Stil	APN	4	115041495	missense	probably damaging	0.99
IGL02826:Stil	APN	4	115024098	missense	probably benign	0.01
IGL02946:Stil	APN	4	115029913	missense	probably benign	0.05
IGL03146:Stil	APN	4	115024415	missense	probably damaging	1.00
BB005:Stil	UTSW	4	115030001	missense	probably damaging	0.98
BB015:Stil	UTSW	4	115030001	missense	probably damaging	0.98
R0058:Stil	UTSW	4	115041298	missense	probably damaging	1.00
R0256:Stil	UTSW	4	115023685	missense	possibly damaging	0.80
R0324:Stil	UTSW	4	115039149	missense	probably benign	0.01
R0391:Stil	UTSW	4	115041172	critical splice acceptor site	probably null
R0602:Stil	UTSW	4	115024423	splice site	probably benign
R0620:Stil	UTSW	4	115007159	missense	possibly damaging	0.52
R1462:Stil	UTSW	4	115023964	missense	probably benign	0.00
R1462:Stil	UTSW	4	115023964	missense	probably benign	0.00
R1544:Stil	UTSW	4	115023852	missense	probably damaging	0.97
R1789:Stil	UTSW	4	115041782	missense	probably benign	0.01
R1878:Stil	UTSW	4	115041226	missense	probably damaging	1.00
R1895:Stil	UTSW	4	115023875	missense	probably benign	0.40
R2325:Stil	UTSW	4	115032707	missense	probably benign	0.12
R2401:Stil	UTSW	4	115016286	missense	probably null	0.81
R3054:Stil	UTSW	4	115004966	missense	probably damaging	1.00
R3055:Stil	UTSW	4	115014069	splice site	probably benign
R4097:Stil	UTSW	4	115023600	missense	probably benign	0.04
R4330:Stil	UTSW	4	115004979	missense	probably damaging	1.00
R4418:Stil	UTSW	4	115009377	missense	probably benign	0.17
R4665:Stil	UTSW	4	115041644	missense	probably benign	0.00
R4688:Stil	UTSW	4	115041308	missense	probably damaging	1.00
R4740:Stil	UTSW	4	115006782	missense	probably benign	0.15
R4860:Stil	UTSW	4	115038474	missense	probably benign	0.01
R4860:Stil	UTSW	4	115038474	missense	probably benign	0.01
R4909:Stil	UTSW	4	115024225	nonsense	probably null
R6130:Stil	UTSW	4	115029861	splice site	probably null
R6523:Stil	UTSW	4	115032714	frame shift	probably null
R7294:Stil	UTSW	4	115007283	missense	probably benign	0.17
R7357:Stil	UTSW	4	115014226	critical splice donor site	probably null
R7387:Stil	UTSW	4	115024036	missense	probably benign	0.37
R7592:Stil	UTSW	4	115023808	missense	probably benign	0.00
R7776:Stil	UTSW	4	115032838	missense	possibly damaging	0.49
R7908:Stil	UTSW	4	115032699	missense	possibly damaging	0.68
R7928:Stil	UTSW	4	115030001	missense	probably damaging	0.98
R9064:Stil	UTSW	4	115041735	missense	probably benign	0.00
R9140:Stil	UTSW	4	115007252	missense	probably damaging	1.00
R9500:Stil	UTSW	4	115021519	missense	possibly damaging	0.93
R9695:Stil	UTSW	4	115024181	missense	probably damaging	1.00
R9697:Stil	UTSW	4	115021504	missense	probably benign	0.45
Z1088:Stil	UTSW	4	115006693	missense	probably damaging	1.00
Z1177:Stil	UTSW	4	115041379	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GATCAGGTGGCTCACAACCACTTAC -3'
(R):5'- CCAGGAGTGCTGCAACATACCTAAC -3'

Sequencing Primer
(F):5'- TTACATTCCACCTACGAAGGC -3'
(R):5'- GCTGCAACATACCTAACATTTATTC -3'

Posted On

2014-03-14