Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Ube4b'

161062

Institutional Source

Beutler Lab

Gene Symbol

Ube4b

Ensembl Gene

ENSMUSG00000028960

Gene Name

ubiquitination factor E4B

Synonyms

UFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1452 (G1)

Quality Score

102

Status

Validated

Chromosome

Chromosomal Location

149328416-149426749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149371169 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 348 (T348A)

Ref Sequence

ENSEMBL: ENSMUSP00000134556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084123

Predicted Effect

probably benign
Transcript: ENSMUST00000103212
AA Change: T348A

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: T348A

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	1083	1.3e-199	PFAM
Ubox	1102	1164	3.94e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172836
AA Change: T348A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: T348A

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	983	7.4e-143	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174343
AA Change: T348A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: T348A

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC

Meta Mutation Damage Score

0.1078

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Ube4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Ube4b	APN	4	149381366	missense	probably benign	0.29
IGL00820:Ube4b	APN	4	149352921	splice site	probably benign
IGL01093:Ube4b	APN	4	149330269	missense	probably benign	0.01
IGL01154:Ube4b	APN	4	149365470	missense	probably benign	0.28
IGL01612:Ube4b	APN	4	149383818	missense	probably damaging	0.98
IGL01800:Ube4b	APN	4	149331494	missense	probably damaging	1.00
IGL02149:Ube4b	APN	4	149398684	missense	possibly damaging	0.88
IGL02472:Ube4b	APN	4	149387079	critical splice donor site	probably null
IGL02839:Ube4b	APN	4	149368399	missense	probably damaging	0.98
IGL03027:Ube4b	APN	4	149381277	missense	probably damaging	1.00
R0143:Ube4b	UTSW	4	149355457	missense	possibly damaging	0.61
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0206:Ube4b	UTSW	4	149398637	missense	probably benign	0.38
R0591:Ube4b	UTSW	4	149357577	intron	probably benign
R1366:Ube4b	UTSW	4	149335149	missense	probably damaging	0.98
R1513:Ube4b	UTSW	4	149351578	missense	probably benign	0.17
R1668:Ube4b	UTSW	4	149361294	missense	probably benign	0.02
R1874:Ube4b	UTSW	4	149347971	missense	probably damaging	1.00
R2002:Ube4b	UTSW	4	149383797	missense	probably benign	0.16
R2050:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R2109:Ube4b	UTSW	4	149372841	missense	probably benign	0.00
R2281:Ube4b	UTSW	4	149344572	missense	probably damaging	1.00
R3547:Ube4b	UTSW	4	149335116	missense	probably damaging	1.00
R3881:Ube4b	UTSW	4	149365404	splice site	probably null
R4378:Ube4b	UTSW	4	149383798	missense	probably damaging	1.00
R4563:Ube4b	UTSW	4	149359165	intron	probably benign
R4674:Ube4b	UTSW	4	149331370	missense	possibly damaging	0.86
R4716:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R5026:Ube4b	UTSW	4	149360565	missense	probably damaging	1.00
R5125:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5178:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5182:Ube4b	UTSW	4	149381242	missense	probably null	0.08
R5229:Ube4b	UTSW	4	149387178	missense	probably damaging	1.00
R5303:Ube4b	UTSW	4	149383803	missense	probably damaging	0.98
R5346:Ube4b	UTSW	4	149337424	missense	possibly damaging	0.91
R5780:Ube4b	UTSW	4	149331364	missense	probably benign	0.00
R5813:Ube4b	UTSW	4	149337468	missense	probably damaging	1.00
R5842:Ube4b	UTSW	4	149331430	missense	probably benign	0.01
R5994:Ube4b	UTSW	4	149372932	missense	probably damaging	0.97
R6020:Ube4b	UTSW	4	149368311	missense	probably benign	0.17
R6125:Ube4b	UTSW	4	149398746	missense	probably benign	0.13
R6272:Ube4b	UTSW	4	149387133	missense	probably damaging	1.00
R6333:Ube4b	UTSW	4	149348037	missense	probably damaging	1.00
R6426:Ube4b	UTSW	4	149425996	unclassified	probably benign
R7203:Ube4b	UTSW	4	149398610	missense	probably benign	0.30
R7341:Ube4b	UTSW	4	149343001	missense	probably damaging	1.00
R7672:Ube4b	UTSW	4	149387204	missense	probably benign	0.10
R7713:Ube4b	UTSW	4	149398781	missense	possibly damaging	0.53
R8175:Ube4b	UTSW	4	149351516	missense	probably benign	0.13
Z1088:Ube4b	UTSW	4	149335125	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CGTTTCTACGAGGAGGAAGTGCATC -3'
(R):5'- GGCCATTTCATAGCCATGCCTCTG -3'

Sequencing Primer
(F):5'- caagagcagccagtgcc -3'
(R):5'- ATGCCTCTGCTCCCAGC -3'

Posted On

2014-03-14